ID: 905409981

View in Genome Browser
Species Human (GRCh38)
Location 1:37761897-37761919
Sequence CAGCAGCATCCCTGGCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905409981_905409985 25 Left 905409981 1:37761897-37761919 CCGCGGCGCCAGGGATGCTGCTG 0: 1
1: 0
2: 0
3: 27
4: 363
Right 905409985 1:37761945-37761967 CCACGAAGATGCGCTGCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905409981 Original CRISPR CAGCAGCATCCCTGGCGCCG CGG (reversed) Exonic
900339166 1:2179732-2179754 CACCAGCAGCCCTGGGCCCGGGG - Intronic
900363419 1:2300784-2300806 CAGGAGCGTCCCTGGCCCCAAGG + Intronic
900436973 1:2635419-2635441 CTGCAGCAGCCCTGGGGCCAGGG + Intergenic
900636570 1:3669058-3669080 CAGCAGCGTCCCTGTCACCTAGG - Intronic
900884658 1:5405800-5405822 CATCAGCTTCCCTGGCTCTGAGG + Intergenic
901001941 1:6153202-6153224 CTGCACCCTCCATGGCGCCGCGG + Intronic
901038941 1:6352541-6352563 CAGCAGCTTCCCTGGCTCCCTGG - Intronic
901146198 1:7066234-7066256 CAGGGGCATCCCTGGCTCCTGGG + Intronic
902180224 1:14682513-14682535 CAGGAGCATCACTGGAGCCCAGG - Intronic
902981353 1:20125754-20125776 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
904449213 1:30600367-30600389 CAGCAGCATCCCTGGGAGCTTGG + Intergenic
905409981 1:37761897-37761919 CAGCAGCATCCCTGGCGCCGCGG - Exonic
905685561 1:39905051-39905073 TAGCAGGATCCCTGGAGCCCAGG - Intergenic
905972787 1:42154120-42154142 CAGCAGCATCCCCTGTGACGTGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906695970 1:47823719-47823741 CAGCAGCATCCAGGCAGCCGAGG + Intronic
907278101 1:53327991-53328013 CAGCGGCAACCCCGGCGCCGCGG - Exonic
908472982 1:64462510-64462532 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
911874925 1:103148639-103148661 CAGGAGCATCACTGGAGCCCAGG + Intergenic
912719030 1:112004230-112004252 CAGCAGCAATCCTGGCACCCAGG - Intergenic
912782837 1:112568780-112568802 CAGGAGGATCCCTGGAGCCCAGG + Intronic
912956291 1:114155957-114155979 CTGCAGCGTCTCTGGCGCCCCGG + Intergenic
913103933 1:115594871-115594893 CAGCAGCACTCCTGGGGCCCAGG - Intergenic
914250603 1:145918691-145918713 CAGCCGCAGCCCAGGCTCCGCGG + Exonic
915304220 1:154968737-154968759 CAGCAGCATCCCTATCCCCAAGG + Intronic
916214921 1:162386096-162386118 CAGCAACATCCCTGCAGCAGGGG - Intronic
916945064 1:169718181-169718203 AAGCAGCATCCCTGGGTCCAAGG + Intronic
917539121 1:175896595-175896617 CAGCAGGATCCCTTGAGCCCAGG + Intergenic
919887643 1:201946516-201946538 CAGCAGCCTCCCTGAAGCCCAGG + Exonic
919905909 1:202078225-202078247 CAGCAGCAGGCCGGGCGCGGTGG - Intergenic
920438609 1:205963948-205963970 CAGCGGCAACCCTGGGGCCTGGG - Intergenic
920821372 1:209384645-209384667 CATCAACATCCCTGTCCCCGTGG + Intergenic
920964237 1:210689055-210689077 CAGCAGCATCCCTGCCCTCCAGG - Intronic
921587052 1:216959592-216959614 CAGCAGGATCCCTGAAGCCCAGG + Intronic
922179722 1:223224242-223224264 CAGGAGGATCCCTGGAGCCCAGG + Intronic
922525561 1:226300321-226300343 CAGCAGGATCCCTTGAGCCCAGG + Intronic
922723754 1:227912946-227912968 CAGGAGCATCCGTGGGGCCCAGG + Intergenic
923106310 1:230856618-230856640 CAGGAGCATCCCTTGAGCCCAGG - Intronic
923607684 1:235459528-235459550 CAGGAGGATCCCTGGAGCCCAGG + Intronic
924588397 1:245380220-245380242 CTGCAGCACCACTGGCCCCGAGG + Intronic
1062815669 10:498230-498252 CAGCAGCATCACTGCAGCCGGGG - Intronic
1062916364 10:1243697-1243719 CAGCAGCATCCTTGCCCCCATGG + Intronic
1063204825 10:3820903-3820925 CAGCAGGATCCCAGACCCCGTGG - Intergenic
1064874223 10:19975165-19975187 CAGCAGAAGGCCTGGCGCAGTGG + Intronic
1065020457 10:21497475-21497497 CAGAGGCGTCCCTGGCGCCTTGG - Intergenic
1065506402 10:26434143-26434165 CAGCAGGATCCCTTGAGCCCTGG + Intergenic
1066467139 10:35662418-35662440 CAGGAGGATCCCTGGAGCCCGGG + Intergenic
1068717080 10:60200442-60200464 GAGCAGCACCCCTGGCACAGTGG - Intronic
1069795799 10:71051004-71051026 CTGCAGCATCCCTGGGACCTGGG + Intergenic
1069969356 10:72152601-72152623 CAGAAGGATCCCTGGAGCCCAGG + Intronic
1070359763 10:75676166-75676188 CAGCAGCTACCCTGGCTCCTGGG + Intronic
1070713727 10:78702448-78702470 CAGCTGCTTCCCTGGCGCCCAGG + Intergenic
1070745062 10:78928674-78928696 CAGCAGCTTCCATGGCTCCCAGG - Intergenic
1074866127 10:117545339-117545361 CCGCAGCCGCCCTGGCGCCGCGG - Intronic
1076091853 10:127693401-127693423 CAGCAGCATGTCTGGGGCTGGGG + Intergenic
1076381136 10:130025175-130025197 CAGCAGCATGGCTGGCGCGGGGG + Intergenic
1076737637 10:132465887-132465909 CAGCGCCATACCTGGCGTCGTGG - Intergenic
1077245998 11:1538827-1538849 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
1077273862 11:1694232-1694254 CAGCCGCATCCCTGCAGCCTTGG + Intergenic
1077285464 11:1763496-1763518 CCGCAGCCTCCCTGGAGACGGGG - Intronic
1077380533 11:2234967-2234989 CAGCAGCGTCCCTGGCCCAGTGG + Intergenic
1077380740 11:2236096-2236118 CAGCAGCGTCCCTGCCCCAGTGG + Intergenic
1080129984 11:28782488-28782510 CAGCAGGATCACTGGAGCCTAGG - Intergenic
1080569712 11:33544876-33544898 CAGCAGCAGCCCTTTGGCCGTGG + Exonic
1081907139 11:46677356-46677378 CAGCAGCAGCCCAGGCCCCAGGG + Exonic
1082102213 11:48182033-48182055 CAGCAGCATCACTGCAGCAGTGG + Intergenic
1083247907 11:61444181-61444203 CAGCAGGATCGCTGGAGCCCAGG + Intronic
1083588213 11:63875773-63875795 CAGCAGCCTCTCTGGCGGCCAGG - Intronic
1083815188 11:65128620-65128642 CACCAGCATCCCTAGCTCAGAGG - Exonic
1083861119 11:65420686-65420708 CAGCAGGATCCCTTGAGCCTAGG - Intergenic
1084202393 11:67569347-67569369 CAGAAGGATCCCTGGAGCCCAGG - Intergenic
1084284203 11:68121118-68121140 CAGCAGCAGCCCGAGCGGCGAGG + Exonic
1084525672 11:69696430-69696452 CAGCAGGATCCCTTGAGCCCAGG + Intergenic
1084939381 11:72604210-72604232 CAGCAGCATGCCTGCCCCCAAGG + Intronic
1085641512 11:78195953-78195975 CAGCAGGATCCCTTGAGCCCAGG - Intronic
1087016590 11:93560067-93560089 AAGCAGCAGCCCTGCAGCCGAGG + Intergenic
1087033167 11:93726505-93726527 CAGGAGGATCCCTGGAGCCCAGG + Intronic
1088059470 11:105629146-105629168 CAGCAGGATCCCTTGAGCCCAGG + Intronic
1088708551 11:112485301-112485323 AAGCAGCATCCATGGCTCTGAGG - Intergenic
1089965294 11:122650608-122650630 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
1090428567 11:126627512-126627534 TAGCAGCCTCCCTGGCTCCATGG + Intronic
1090827318 11:130396857-130396879 CAGGAGCATCACTGGAGCCTAGG + Intergenic
1091044291 11:132312126-132312148 CTGCAGCATCCCTGCCTCTGAGG + Intronic
1091219317 11:133920790-133920812 CAGCAGCAGCCCTGGGGAGGTGG - Exonic
1091771172 12:3152236-3152258 CAGCAGCCTCCCTGGTGGCCAGG - Intronic
1091780052 12:3208069-3208091 CAGCAGGAGGCCTGGCGCCTTGG + Intronic
1091838942 12:3605426-3605448 CGGCAGCTTCCCTGGCGAGGAGG - Intergenic
1093453648 12:19342682-19342704 CAGCAGAATCACTTGCGCCCAGG + Intronic
1095214722 12:39534582-39534604 CAGAAGCATCCCTTGAGCCCAGG + Intergenic
1095485294 12:42678441-42678463 CAACACCATCCCTGGCTCCTGGG + Intergenic
1095760355 12:45826505-45826527 CAGGAGGATCCCTTGGGCCGAGG - Intronic
1096075467 12:48801138-48801160 CAGCAGCCTCCCATGCTCCGGGG + Intergenic
1096620189 12:52859726-52859748 CAGAAGCTTCCCTGGTGCTGGGG + Intergenic
1097114408 12:56687334-56687356 CAGCCGCTTCCCTGGCAGCGAGG - Intronic
1099343688 12:81471389-81471411 CAGCAGGATCCCTTGAGCCCAGG - Intronic
1099933844 12:89102901-89102923 CAGGAGGATCCCTGGAGCCTAGG - Intergenic
1101005381 12:100396519-100396541 CAGGAGGATCCCTGGAGCCCAGG + Intronic
1102481450 12:113226754-113226776 GAGCAGCACCCCTGGCCCAGTGG + Exonic
1103557185 12:121773688-121773710 CAGCTGCATACCAGGCCCCGAGG + Intronic
1103921990 12:124403981-124404003 CAGCAGCAACCTGGGGGCCGGGG - Intronic
1104089905 12:125507614-125507636 CAGCAGCATGGCTGGAGCTGGGG + Intronic
1104165395 12:126224146-126224168 CAGCAGGATCCCTTGTGCCCAGG - Intergenic
1104801628 12:131558646-131558668 CAGCACCCTCCCTGGCCCCAGGG + Intergenic
1105851422 13:24339667-24339689 CAGCTGCATTCCTGAAGCCGGGG + Intergenic
1106109286 13:26762181-26762203 CAGCAGCATCACTGGGGAAGAGG - Intergenic
1106513721 13:30434229-30434251 CAGGAGCATCACTGGAGCCCAGG + Intergenic
1108383112 13:49873074-49873096 CAGCAGAATCACTGGAGCCCAGG - Intergenic
1108667281 13:52645284-52645306 CAGGAGCATCCCTTGAGCCCAGG - Intergenic
1110018941 13:70444204-70444226 CAGCAGGATCCCTTGTGCCCAGG - Intergenic
1110900794 13:80821604-80821626 CAGCAGGATCCCTTGAGCCCAGG - Intergenic
1113586491 13:111469552-111469574 CAGCAGCAGCCCTGGCTCAGAGG - Intergenic
1113695593 13:112343262-112343284 CAGCAGCGCCCCTGGGCCCGCGG + Intergenic
1114452732 14:22837513-22837535 TACCCGCATCCCTGGCGTCGAGG + Intronic
1115338200 14:32263302-32263324 CACCAGCATCACTACCGCCGTGG + Intergenic
1116991880 14:51285634-51285656 CAGCAACATCCCTGGCCCCCAGG - Intergenic
1117252434 14:53950805-53950827 CAGCAGCATCCCTGAGAACGAGG - Exonic
1117340758 14:54789307-54789329 CAGCAGAAGCCCTGGCCCTGGGG + Exonic
1118201304 14:63676499-63676521 CAGTAGAATCCCTTGCGCCCAGG - Intergenic
1118213570 14:63787914-63787936 CACCAGCATCCATGGCACCCAGG + Intergenic
1118620210 14:67608149-67608171 CAGCAGGATCCCTTGAGCCCAGG + Intergenic
1121969143 14:98340465-98340487 CATCAGCTTCCCTGGCTCTGGGG + Intergenic
1122196615 14:100092147-100092169 CAGGAGGATCCCTTGCGCCCAGG + Intronic
1122425676 14:101603918-101603940 CAGGAGCATCCCTTGAGCCCAGG + Intergenic
1122503857 14:102219353-102219375 CAGCGGCATGCAGGGCGCCGAGG + Intronic
1123072328 14:105647865-105647887 CAGCAGCATCACTGGAGCCCAGG - Intergenic
1124345303 15:28918215-28918237 CAGAAGCGTTCCTGGCGCCACGG + Intronic
1126426912 15:48537646-48537668 CAGCCTCACCCCTGCCGCCGTGG - Exonic
1126935397 15:53701446-53701468 CAGGAGGATCCCTGGAGCCCAGG + Intronic
1128969254 15:72092482-72092504 CAGCAGGATCCCTTGAGCCCAGG + Intronic
1129285564 15:74521825-74521847 CAGGAGAATCCCTGGAGCCCAGG + Intergenic
1129545189 15:76388361-76388383 CAGGAGCATCACTGGAGCCTAGG + Intronic
1129592751 15:76931861-76931883 CAGCAGCAGCCCCAACGCCGCGG - Exonic
1131754976 15:95549904-95549926 CCACAGCATCCCTGCTGCCGAGG - Intergenic
1132179432 15:99741419-99741441 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
1132776260 16:1596209-1596231 CAGCCTCCTCCCTGGAGCCGAGG + Intronic
1132781028 16:1625803-1625825 AAGCAGCCTCGCTGGTGCCGTGG + Intronic
1132860648 16:2070048-2070070 CTCCAGCAACCCTGGGGCCGAGG - Intronic
1133181245 16:4056344-4056366 CAGGAGAATCCCTGGAGCCCGGG - Intronic
1134096929 16:11424316-11424338 CAGGAGCATCCCTGCCTCGGAGG + Exonic
1134239494 16:12494981-12495003 CGTCAGTATCCCTGGGGCCGAGG + Intronic
1134258513 16:12631068-12631090 CAGCAGCAGCGCTGGCTCTGGGG - Intergenic
1135981241 16:27149063-27149085 CAGGAGGATCCCTGGAGCTGGGG + Intergenic
1137611148 16:49818480-49818502 CAGCAGGATCACTGGAGCCCAGG + Intronic
1137695827 16:50461353-50461375 GAGCAGCATCTCTGGCCCTGAGG - Intergenic
1137905578 16:52318755-52318777 CAGCAGCATCCCTGGGGAGAGGG - Intergenic
1138491938 16:57382174-57382196 CAGGACCACCCCTGCCGCCGGGG + Exonic
1138514386 16:57528038-57528060 CAGCAGGATCCCTTGAGCCCAGG - Intronic
1138529452 16:57627186-57627208 CTGCAGCAGCCCTGGCTCCTAGG + Intronic
1138635195 16:58332766-58332788 CAGGAGAATCACTGGCACCGGGG - Intronic
1140776924 16:78257440-78257462 CAGCTCCATCCCTGGCTCGGAGG - Intronic
1141139596 16:81488675-81488697 CAGGAGCCTCCCTGGTGCTGCGG - Intronic
1141167865 16:81672239-81672261 CAGCAGCATCCCTGGCTTCTGGG - Intronic
1142196842 16:88742913-88742935 CAGCTGCCTCCCTGGGGCTGAGG + Intronic
1142411235 16:89918237-89918259 CAGCTGCAGCCCTGGGGCTGTGG - Exonic
1142649732 17:1340502-1340524 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
1142764406 17:2057388-2057410 CAGCGGCCGCTCTGGCGCCGCGG - Exonic
1142878038 17:2864150-2864172 CAGCAGCAGCCCTGCCACCTAGG + Intronic
1143057503 17:4173305-4173327 GAGCAGCAGGCCAGGCGCCGCGG + Intronic
1143353504 17:6307187-6307209 CAGCAGCATCCCAGGGGTCTTGG + Intergenic
1143995544 17:11003483-11003505 CTGCAGGATCCCTGGCCCCATGG + Intergenic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1144428617 17:15170070-15170092 CCACAGCATCCCTGGTGCCTGGG + Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1147180150 17:38679430-38679452 CAGGAGAATCCCTTGAGCCGAGG - Intergenic
1147712984 17:42483498-42483520 CAGGAGCATCACTTGCGCCTAGG - Intronic
1147953424 17:44119591-44119613 CAGCAGGATCCCTGGGCCCCTGG + Intronic
1147979127 17:44263860-44263882 CAGGAGGATCCCTGGGGCCCAGG - Intronic
1148439689 17:47705397-47705419 CAGCAGAGTGCCTGGCCCCGGGG + Intronic
1151135143 17:71939251-71939273 CGGCAGCATCCCTGGCCTCTAGG + Intergenic
1152364119 17:79845110-79845132 AAGCAGCAGCCCGGCCGCCGTGG - Intergenic
1152371102 17:79889108-79889130 CAGCGGCTTCCCTGGCTCTGAGG + Intergenic
1152439879 17:80300355-80300377 CAGCAGAATCGCTTGTGCCGAGG - Intronic
1153306401 18:3635555-3635577 CAGCAGCTTCCCTGGTCCCCAGG - Intronic
1153760768 18:8329889-8329911 CAGGAGGATCCCTTGAGCCGAGG - Intronic
1153794383 18:8609426-8609448 CAGCAGCATCCCGGACGAGGAGG - Exonic
1153879077 18:9404853-9404875 CTGAAGCCTCCCTGGCTCCGGGG + Intergenic
1154144754 18:11857818-11857840 CAGCAGGATCACTGGAGCCCAGG - Intronic
1154263567 18:12859863-12859885 CAGCAACAAGCCTGGCGCAGTGG + Intronic
1154337211 18:13475297-13475319 CAACAGGATCCCTGGAGCCCAGG + Intronic
1156504223 18:37578620-37578642 CAGCACCATGCTTGGCACCGTGG + Intergenic
1156674582 18:39512415-39512437 AAGCAGCTTCCCTGGTGCCTAGG + Intergenic
1157210145 18:45735294-45735316 CATCAGAAACCCTGGGGCCGGGG - Intronic
1157809976 18:50688007-50688029 CAGCAGAATCCCTGACCCCGAGG - Intronic
1157841953 18:50967344-50967366 CAGCAGCTGGCCGGGCGCCGTGG - Intergenic
1158212700 18:55068625-55068647 CAGCAGGATCCCTTGTGCCCAGG - Intergenic
1158559729 18:58503890-58503912 CCACAGCATCCCTGGAGCCTGGG + Intronic
1159431233 18:68356341-68356363 CAGCAGCAGGCCTGGGGCCAAGG + Intergenic
1160174105 18:76579152-76579174 CGGCAGCATCCCTGGAGGTGGGG - Intergenic
1160666394 19:331574-331596 CAGGAGCATCCCTTGAGCCCAGG + Intronic
1161726507 19:5932424-5932446 AAACAGCAGCCCTGGCGCCCAGG - Intronic
1161812297 19:6477674-6477696 CAGCAGGATCCCTTGAGCCCAGG - Intronic
1161972177 19:7588611-7588633 CAGGAGCATCCCTTGAGCCTGGG - Intergenic
1162033042 19:7925579-7925601 CAGCCTCATCCCCGGCGCCCGGG - Intronic
1162068877 19:8141975-8141997 CAGCCACACCCCTGCCGCCGCGG - Exonic
1162142458 19:8592798-8592820 CAACAGCATCCCGGCCGCCGAGG - Exonic
1162605079 19:11700566-11700588 CAGGAGCATCACTGGAGCCCAGG - Intergenic
1164525613 19:29011121-29011143 GAGCAGCATCCCTGCCACAGTGG + Intergenic
1165348877 19:35266171-35266193 CTGCAGCATCCCTGAGGCTGGGG - Intronic
1165426666 19:35749710-35749732 CAGGAGGATCGCTGGAGCCGGGG + Intronic
1166043860 19:40218183-40218205 CAGCAGCCTGCGTGCCGCCGTGG - Exonic
1166675654 19:44739069-44739091 CCACAGCATCCCAGGCTCCGCGG + Intergenic
1166751207 19:45164761-45164783 CAGCCGCTGCTCTGGCGCCGGGG + Intronic
1166948876 19:46413359-46413381 CAGCCGCGTCCCTGGGGCCTGGG - Exonic
1167000925 19:46745677-46745699 CAGAAGCTTGCCGGGCGCCGAGG - Intronic
1167273498 19:48520396-48520418 CAGGAGGATCCCTGGAGCCTAGG + Intergenic
1167613324 19:50517669-50517691 CAGCAGCAACCCCAGCGGCGGGG - Exonic
1167646765 19:50710254-50710276 CAGCAGTATGCCTGGAGCCCAGG - Intronic
1167711661 19:51115477-51115499 CAGCACCATCCCTGCTGCCCGGG + Intergenic
1167768631 19:51500365-51500387 CAGCAGCATCTCTGAGGCAGAGG + Intronic
1167880927 19:52456688-52456710 CTGCATCATCCCTGGTGCTGTGG + Intronic
1168301442 19:55407390-55407412 CCGCAGTCTCCCTGGCGGCGAGG - Intronic
1168394994 19:56040041-56040063 CAGGAGGATCCCTGGAGCCTGGG - Intronic
1168656659 19:58134175-58134197 TAGCAGCATCCGTGGCTCCTAGG - Intronic
925070894 2:965634-965656 CAGCAGCAGCCCCCGAGCCGAGG - Intronic
925172131 2:1756602-1756624 TAGCAGCATCCATGGTGCCTGGG - Intergenic
925181823 2:1822479-1822501 CAGGAGCATCCCTGGGGAAGAGG - Intronic
925421223 2:3713477-3713499 CAGCTGCATCCCGGGTGCCCAGG + Intronic
926045819 2:9708889-9708911 CAGCAGCATCCCAGCCTCCCAGG - Intergenic
927200098 2:20572827-20572849 CAGCTGCAGCCCTGGAGCAGGGG - Intronic
927304766 2:21558188-21558210 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
928340992 2:30442973-30442995 CAGGAGGATCCCTGGGGCCCAGG + Intergenic
929830737 2:45344407-45344429 CAGCAGCATGCCTGGGGCCACGG - Intergenic
930685201 2:54300336-54300358 CAGCAGCATTCCTGGCTTCTGGG - Intronic
931284729 2:60822470-60822492 CATCAGAATCCCTGGAGCCATGG - Intergenic
932346889 2:71001473-71001495 CAGCAGGAGCCCTGATGCCGAGG - Intergenic
933356212 2:81211893-81211915 GACCAGAATCCCTGGGGCCGAGG - Intergenic
933714562 2:85350574-85350596 CAGCAGCAGCCGTGGAGCCAAGG + Intronic
935406899 2:102718842-102718864 CAGCAGCATGCTGGGGGCCGTGG - Exonic
935498703 2:103811826-103811848 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
936048623 2:109205770-109205792 CAGCAGCCTCCCTGAAGCAGCGG + Intronic
936252314 2:110876312-110876334 CAGAACCCTCCCTGGCACCGTGG - Intronic
937019762 2:118639710-118639732 CAGCAGAATCTCTGGGGCTGGGG - Intergenic
937262842 2:120597450-120597472 CAGCAGCATCTCTGGAGCGGAGG - Intergenic
939488160 2:142843133-142843155 CAGGAGAATCCCTGGAGCCCAGG + Intergenic
941804273 2:169694578-169694600 CAGGAGCGTCACGGGCGCCGGGG + Exonic
941962087 2:171263522-171263544 CAGCTGCCTCCCTGGCGCCAGGG + Intergenic
942043287 2:172084912-172084934 CTGCCGCATCCCTGGAGTCGGGG - Intronic
945948081 2:216013432-216013454 CAGCGGCAGCCCGGGCGTCGCGG + Exonic
946339620 2:219059182-219059204 CAGCATGCACCCTGGCGCCGGGG - Intronic
946803474 2:223446257-223446279 CAGCAGCATCACTTGAGCCCAGG - Intergenic
947105837 2:226667159-226667181 CAGGAGCATCCCTGGAGACCAGG + Intergenic
947854816 2:233315985-233316007 CAGCAGCAGCCCGGGCGCGGTGG - Intronic
948609102 2:239155510-239155532 CAGCCACATCCCTGGAGCCGTGG - Intronic
948609116 2:239155579-239155601 CAGCCACATCCCTGGAGCAGAGG - Intronic
948615162 2:239193690-239193712 CAGCAGCAACTCTGGTGCTGGGG + Intronic
1169219913 20:3816143-3816165 CTGCAGCATCTCTGGGGCCGAGG + Intergenic
1172392704 20:34576712-34576734 CAGGAGGATCCCTGGAGCCCAGG - Intronic
1172712446 20:36936411-36936433 CAGGAGGATCCCTGGAGCCTAGG - Intronic
1173686741 20:44929167-44929189 CAGGAGGATCCCTGGAGCCCGGG + Intronic
1175376453 20:58528504-58528526 CAGCAGGATCCCTTGAGCCCAGG - Intergenic
1175521745 20:59606173-59606195 CATCAGAATCCCTGGGGCCCGGG + Intronic
1175645000 20:60663640-60663662 CACCTGCATCCCTGGAGCCTGGG - Intergenic
1175936199 20:62515216-62515238 CAGCAGGCTCCCCGGCCCCGGGG - Intergenic
1175946838 20:62562850-62562872 CAGCAGCGTCCCCTGCCCCGGGG - Intronic
1178200126 21:30394062-30394084 CAGCAGCATAGCTGGAGCAGCGG - Intronic
1178301400 21:31456375-31456397 CAGTAGCCTCCCTGCCGCCCTGG + Intronic
1179181919 21:39053066-39053088 GAGAAGCATTTCTGGCGCCGTGG - Intergenic
1179962861 21:44780281-44780303 CAGCAGCATGCCTGACCCCATGG + Intronic
1179968180 21:44818552-44818574 CACCCGCCTCCCTGCCGCCGCGG + Intronic
1181085134 22:20436400-20436422 CCGCTGCATTCCTGGGGCCGGGG + Intronic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1181930804 22:26399912-26399934 CAGCAGGATCCCTTGAGCCCAGG + Intergenic
1182318565 22:29463807-29463829 CTGCAGCATCCCTGTCACTGTGG - Intergenic
1182356856 22:29726098-29726120 CAGATGCTTCCCTGGCCCCGGGG + Intronic
1182664276 22:31945437-31945459 CAGCAGCAAACCTGGGGCTGTGG - Intronic
1183454914 22:37917372-37917394 CAGCAGCTTCCCTGCCACCAGGG - Intronic
1184301095 22:43561503-43561525 CGGCAGCATCCATGGGGCCTGGG - Intronic
1184685482 22:46094906-46094928 CGGCAGCTGCCCTGGCGCAGGGG + Intronic
1184720334 22:46308916-46308938 AAGAAGCATCCCTGGGGCTGCGG + Exonic
1185246634 22:49776374-49776396 CAGGAGCTTCCCTGGGTCCGTGG - Intronic
1185324407 22:50218678-50218700 CAGCAGCAGCCCTGGCCGCGGGG - Intronic
949815452 3:8053250-8053272 CAGCAGAATGCCTGGCACAGAGG + Intergenic
949982239 3:9509012-9509034 CAGGAGCATCCCCGTCTCCGTGG + Intronic
950260733 3:11542047-11542069 CCGCTGCATCCCTGGCCCTGTGG - Intronic
950980383 3:17297815-17297837 CAGCAGGATCACTGGAGCCCAGG - Intronic
954894598 3:53964814-53964836 CAGCACCATGCCTGGCACCTTGG + Intergenic
955406567 3:58629429-58629451 CAGCACTATGCCTGGCGCAGAGG + Intergenic
955558701 3:60165176-60165198 CAGCAGCTTCCCTGGCACGGTGG - Intronic
958007696 3:87833592-87833614 CAGCAGGATCCCTTGAGCCCAGG - Intergenic
960718712 3:120604208-120604230 TAGCAGCAACCCTAGCTCCGTGG + Intergenic
961348958 3:126287061-126287083 CAGGAGCATCCCTTGAGCCTAGG - Intergenic
963253316 3:143120916-143120938 CAGCGGCGTCCTGGGCGCCGGGG - Exonic
964041818 3:152269499-152269521 CTCCCGCATCCCTGGCCCCGGGG + Intronic
964857504 3:161162577-161162599 CAGCAGGATCGCTGGAGCCCGGG + Intronic
966366561 3:179194444-179194466 CAGCAGGATCCCTTGAGCTGAGG - Intronic
966373325 3:179271073-179271095 CAGCAACATTCCTGGCGCAAAGG - Intergenic
966911329 3:184561968-184561990 CAGGAGGATCCGGGGCGCCGGGG - Exonic
966913627 3:184573037-184573059 CACCTGCATCCCTAACGCCGTGG + Exonic
967653223 3:192012643-192012665 CAGCAGCATCCCTTCCTCAGAGG + Intergenic
967735959 3:192952837-192952859 CAGCAGCAGGCCGGGCGCGGTGG + Intergenic
968202171 3:196764087-196764109 CAGCAGCAGGCCGGGCGCGGTGG - Intronic
968502381 4:956963-956985 CTGGAGCATCCCTGGCACCTGGG - Intronic
968786644 4:2626868-2626890 CTGCATCATCCCTGGCACAGGGG - Intronic
969476122 4:7423339-7423361 GAGCAGCATCCCTGGCTATGTGG + Intronic
969591620 4:8125590-8125612 CAGAAGCAGCCCCGGCACCGAGG - Intronic
969639577 4:8388823-8388845 CAGCAGCAGCCCAGGCACCAGGG + Intronic
971313108 4:25543527-25543549 CAGGAGCATCCCTTGAGCCCAGG + Intergenic
971792084 4:31182977-31182999 CAGCAGAATCGCTTGCCCCGGGG + Intergenic
972488186 4:39562144-39562166 CAGGAGGATCCCTGGAGCCCAGG + Intronic
972554007 4:40162873-40162895 CATCAGCTTCCCTGGCTCTGTGG - Intergenic
972595529 4:40526664-40526686 CAGGAGGATCCCTGGAGCCAGGG - Intronic
972768787 4:42176165-42176187 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
974813852 4:66981401-66981423 CAGCACCATCCCTGGAGCTTAGG - Intergenic
975608520 4:76180259-76180281 CAGGAGGATCCCTGGAGCCCAGG + Intronic
976598806 4:86918967-86918989 CATCAGCTTCCCTGGCTCTGAGG - Intronic
978189448 4:105895523-105895545 CAGCAGTAGCCCGGGCGGCGAGG + Exonic
982664538 4:158245342-158245364 CAGCAGCATCACTTGAGCCCAGG + Intronic
982734546 4:158991982-158992004 CAGGAGGATCCCTGGAGCCCAGG - Intronic
982797086 4:159659210-159659232 CAGCAGCTTCCCTGGTTCTGAGG + Intergenic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985049561 4:185975345-185975367 CAGGAGGATCCCTTGAGCCGAGG - Intergenic
985692081 5:1319158-1319180 CAGCAGCGTCCGGGGCTCCGTGG + Intronic
986726406 5:10601399-10601421 CTCCACCATCCCTGGCGCTGCGG + Intronic
987003605 5:13686819-13686841 CAGCAGCTGCTCTGGCTCCGGGG + Intergenic
988482608 5:31642278-31642300 CAGCATCCTCCCTGGTGCTGCGG - Intronic
990263695 5:54053156-54053178 CAGAAGGATCCCTGGGGCCCGGG + Intronic
990612174 5:57468588-57468610 CAGCAGCATCCCTTACGGCAGGG - Intergenic
992034653 5:72760666-72760688 CAGCAGCCTCCCTGGTTCTGAGG + Intergenic
992296412 5:75331120-75331142 CAGGAGAATCCCTGGAGCCTGGG - Intergenic
992666993 5:79020006-79020028 CAGCAGCATCACTGTCACCTGGG - Intronic
995679170 5:114697822-114697844 CAGCAGCATCACTTGAGCCCAGG - Intergenic
999192169 5:149756566-149756588 AAGCAGCATCCCTGGCCTCGGGG + Intronic
1001123511 5:168998793-168998815 CAGCAGCATCACTGTCACCTAGG + Intronic
1002098692 5:176846792-176846814 CAGCCACAGTCCTGGCGCCGAGG + Intronic
1002105424 5:176877432-176877454 CAGCAGCATCCCAGGGGCCAGGG - Intronic
1002851826 6:1003519-1003541 CAGCAGCTTCCCTGTCAGCGTGG + Intergenic
1002898194 6:1391018-1391040 CAGCAGCAACCCCGCCGCCTCGG + Exonic
1009993205 6:70869240-70869262 CAGGAGCATCCCTCGAGCCCAGG - Intronic
1010710570 6:79169836-79169858 CAGTATCATGCCTGGCGCTGTGG + Intergenic
1010781178 6:79947432-79947454 CTGCCGCATCCCCGCCGCCGCGG - Exonic
1015787907 6:136936880-136936902 CACCAGCACCCCTGGCACCCAGG + Intergenic
1016034565 6:139373434-139373456 CAGCAGCACCCCCGGCGGCTCGG - Exonic
1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG + Intergenic
1017140259 6:151183697-151183719 CAGCAGAATCCCTTGAGCCTAGG - Intergenic
1018587407 6:165376824-165376846 TAGGAGGATCCCTGGCGCCCAGG + Intronic
1018769059 6:166956394-166956416 CCGCAGCAGCCCTGGCGACCCGG + Exonic
1019413074 7:914995-915017 CAGCAGCCTCCCTGCAGCCGGGG + Intronic
1019906724 7:4070490-4070512 CTGCAGCATCCCAGGTGCCCTGG + Intronic
1021638835 7:22718543-22718565 CAGCAGCAGCCCAGGGGCCTAGG - Intergenic
1022316409 7:29249210-29249232 CATCGGCATCCCTGGCTCTGAGG - Intronic
1023421420 7:39984191-39984213 CAGGAGGATCCCTGGAGCCCAGG + Intronic
1024440991 7:49417252-49417274 TAGCAGCATGCCTGGCACAGTGG + Intergenic
1024723154 7:52161213-52161235 CAGCAGAAGGCCAGGCGCCGTGG + Intergenic
1025165609 7:56709655-56709677 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
1025736009 7:64147365-64147387 CAGGAGGATCCCTGGAGCCCAGG + Intronic
1026199780 7:68204710-68204732 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
1026902593 7:74045282-74045304 CAGCTGCATACCTGGAGCCTTGG - Exonic
1027141158 7:75658626-75658648 CAGCAGGAGGCCAGGCGCCGTGG + Intronic
1027525090 7:79258720-79258742 CAGGAGGATCCCTTGAGCCGAGG - Intronic
1030621448 7:111795325-111795347 CAGCTTCATCCCTGGCCCCAGGG + Intronic
1032971057 7:137164378-137164400 CAGCGGCATCCTCGGGGCCGGGG + Intergenic
1033175648 7:139121202-139121224 CAGGAGCATCCCTTGAGCCCCGG - Intergenic
1033360399 7:140635168-140635190 CAGCAGGATCCCTTGAGCCCAGG + Intronic
1034463266 7:151210275-151210297 CGGCAGCAGCCCGGGGGCCGTGG - Intronic
1034680789 7:152925841-152925863 CAGCTCCATCCCCGGCGCTGGGG + Intergenic
1035678154 8:1469261-1469283 CAGCAGCCACCCTGGCTCCCAGG + Intergenic
1036035842 8:5018037-5018059 CTGCAGCACCCTTGGCCCCGTGG + Intergenic
1037858632 8:22389268-22389290 CAGCAGCATCACTGACACCTGGG - Intronic
1040424207 8:47268683-47268705 CAGGAGCATCCCTTGAGCCCAGG - Intronic
1040709372 8:50169846-50169868 CAGGAGGATCACTGGAGCCGAGG + Intronic
1040922446 8:52637428-52637450 CAGCAGGATCCCTTGAGCCTAGG - Intronic
1042823518 8:72957319-72957341 CATCGGCATCCCTGGTGCTGGGG - Intergenic
1043579772 8:81698839-81698861 CAGCAGGATCACTGGAGCCCAGG - Intergenic
1046025186 8:108713845-108713867 CATCAGCTTCCCTGGCTCTGAGG - Intronic
1046820641 8:118630592-118630614 CATCAGCTTCCCTGGCTCTGAGG + Intergenic
1047769479 8:128019145-128019167 CAGCAGCATCCTGGGCACCGTGG - Intergenic
1048189922 8:132278656-132278678 CATCAGCATCCCTGGAGGTGTGG + Intronic
1049039935 8:140104970-140104992 CAGCAGCAGCCCTGACTGCGTGG + Intronic
1049065351 8:140309232-140309254 GAGCAGCATGCCTAGCGCCTAGG - Intronic
1049317244 8:141975828-141975850 TATCAGCATCCCTGGCTCCTGGG - Intergenic
1052638122 9:31128973-31128995 CAGGAGGATCCCTGGAGCCCAGG - Intergenic
1054447667 9:65385479-65385501 CAGGAGCATCGCGGCCGCCGCGG + Intergenic
1055400005 9:75913158-75913180 CAGCAGCATACCAGGTGCTGAGG - Intronic
1055576833 9:77668691-77668713 CAGCAGCTTCCCTGGTTCTGAGG + Intergenic
1057607820 9:96513550-96513572 CTGCAGCATCCTTGGAGCCTCGG + Intronic
1059174026 9:112152845-112152867 CAGGAGGATCCCTTGAGCCGAGG - Intronic
1060104073 9:120862662-120862684 CAGCAGCTTCCCTGGCGGGTTGG + Exonic
1060991995 9:127854615-127854637 CAGCAGCAGTCCTGGCCCCAGGG + Exonic
1061808264 9:133148418-133148440 CAGCAACATGCCTGGGGCCATGG - Intronic
1062106505 9:134757843-134757865 CAGCTGTATCCATGGTGCCGAGG - Intronic
1186226308 X:7402500-7402522 CAGCAGCAGCCCTGCCCCCCAGG - Intergenic
1187182985 X:16960272-16960294 CAGCAGGATCGCTGGAGCCGAGG + Intronic
1188788597 X:34380272-34380294 CAGAAGGATCCCTTGAGCCGAGG - Intergenic
1189236851 X:39493827-39493849 CAGCAGCATCCATGTCACCTGGG + Intergenic
1195287204 X:103396756-103396778 CAGCAGCCTTCCTGGCTCCCAGG - Intergenic
1195371034 X:104173059-104173081 CAGGAGGATCCCTGGAGCCCAGG - Intronic
1197181032 X:123537736-123537758 CAGGAGGATCACTGGCGCCTTGG - Intergenic
1198207237 X:134478518-134478540 CAGGAGCATCCCTTGAGCCTAGG + Intronic
1200112449 X:153748461-153748483 CAGGAGGATCCCTGGAGCCCAGG + Intergenic
1200221958 X:154395062-154395084 CAGGAGCATCTCTGGAGCCCAGG + Intronic
1200247775 X:154535053-154535075 GGGCAGCATCCATGGTGCCGGGG - Intronic