ID: 905410628

View in Genome Browser
Species Human (GRCh38)
Location 1:37765626-37765648
Sequence GGGGATGAGCTAGGAGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905410628 Original CRISPR GGGGATGAGCTAGGAGACAC CGG (reversed) Intergenic
901451235 1:9338128-9338150 GGGGAGGAGCGAGGGGACAGGGG - Intronic
903284598 1:22268780-22268802 GGGGCTGAGAAAGGAGAGACGGG + Intergenic
904939783 1:34157581-34157603 GGGAATGTGTTAGAAGACACTGG - Intronic
905410628 1:37765626-37765648 GGGGATGAGCTAGGAGACACCGG - Intergenic
909063034 1:70901089-70901111 GGGGATCAGCCAGGAGACTAAGG - Intronic
913031635 1:114910863-114910885 GGGGATGAGCCAGGAAGCACAGG - Intronic
913695791 1:121324242-121324264 GGGGATGTACAAGGAGAAACAGG - Intronic
914141775 1:144955815-144955837 GGGGATGTACAAGGAGAAACAGG + Intronic
915301968 1:154956832-154956854 GGGGATGGGCGGGGAAACACAGG + Intergenic
915598241 1:156907391-156907413 GGGGGTGAGCAAAGAGCCACGGG - Intronic
915923071 1:159992594-159992616 GGGGAGCAGGGAGGAGACACAGG - Intergenic
917436927 1:175031512-175031534 GGGAGTGAGCTAGGAGGCTCTGG + Intergenic
918114565 1:181485114-181485136 GGGGATGGGGTTGGAGACATGGG + Intronic
919567354 1:199205642-199205664 GGGGAAGAGCTTGGAAAAACAGG - Intergenic
920483116 1:206342610-206342632 GGGGATGTGCAAGGAGAAACAGG - Intronic
920644955 1:207795610-207795632 GGGTCTGAGCTAGGAGGGACAGG - Intergenic
921667873 1:217894596-217894618 GGGGCTGAGGCAGGAGAAACCGG - Intergenic
922507459 1:226134810-226134832 GGGGATGAGATCGGAGAAAGAGG - Intergenic
923036264 1:230287147-230287169 GGGGAGGAGTCAGGAGACTCAGG + Intergenic
923333484 1:232947074-232947096 GAGGATGAGCAAGGAGTGACTGG + Intergenic
924687735 1:246312690-246312712 TGGGATGAGCTCAGAAACACAGG + Intronic
1062967914 10:1624408-1624430 GGGGCTGTGCTCGGAGCCACGGG - Intronic
1063624467 10:7676263-7676285 GGGGGTGAGGGAGGAGCCACTGG + Intergenic
1064585735 10:16837736-16837758 ACGGATGAGCTGGGAGAAACTGG - Intronic
1066676313 10:37891325-37891347 GGGCAAGAGCAGGGAGACACAGG - Intergenic
1067045484 10:42982957-42982979 AGGGCAGGGCTAGGAGACACGGG - Intergenic
1067323500 10:45244641-45244663 ACGGATGAGCTGGGAGAAACTGG - Intergenic
1068911457 10:62382528-62382550 GGGGATGTGATAGGAGGCAGGGG - Intronic
1069570848 10:69493448-69493470 GGAGATGGGCTCGGAGAAACTGG - Intronic
1070683120 10:78462936-78462958 GGGGCTGAGCTGGGAGAGAGTGG - Intergenic
1071786490 10:88906086-88906108 GGGGACAAGTTGGGAGACACAGG + Intronic
1072426882 10:95337411-95337433 GAGGATGAGCAAGGACACTCTGG + Intronic
1073283087 10:102369023-102369045 GGGGATGGGAAAGGAGATACAGG + Intronic
1073899007 10:108197499-108197521 TGGGATGAGCTAGTAGAAAAGGG - Intergenic
1074970718 10:118534305-118534327 GGGGCTGACGTAGGAGACAGAGG - Intergenic
1075101677 10:119510485-119510507 GGGGATGAGCTGAGAGGTACTGG - Intronic
1076978584 11:193359-193381 TGGGCTGGGGTAGGAGACACTGG - Intronic
1077125499 11:933738-933760 GGGGATGACCCCAGAGACACAGG + Intronic
1077399010 11:2343873-2343895 GAGGATGAGCTAATACACACAGG + Intergenic
1078548107 11:12261013-12261035 GGGGATCCGCTGGGAGCCACAGG - Intronic
1078897214 11:15607337-15607359 GGGGATGGGCCAGGAGAAGCAGG + Intergenic
1080430019 11:32189457-32189479 GGGTATGTGCTAGAAGGCACCGG - Intergenic
1080640181 11:34154164-34154186 GGGGATGAGCTAGGAGATGCAGG - Intronic
1081733931 11:45390762-45390784 TGGGATGAGATTGGAGACAGAGG - Intergenic
1083856100 11:65393860-65393882 GGGGATGGGCTGGGAGCCACCGG + Intronic
1084219845 11:67671138-67671160 TGGGATGAGCTATGGCACACAGG + Intronic
1084675092 11:70629556-70629578 CGGGATGAGCTGGCAAACACTGG + Intronic
1086297598 11:85388169-85388191 GGGGAAAAGCTAGCAGCCACTGG - Intronic
1089584365 11:119500940-119500962 GCCCATGAGCTTGGAGACACTGG + Intergenic
1089644778 11:119871632-119871654 GGGGATGAACTTGGATACTCAGG + Intergenic
1090428528 11:126627283-126627305 GGAGATGAGGAAGGAGACAGAGG + Intronic
1092030941 12:5284630-5284652 GGGGATGAGGAAGGGGGCACTGG - Intergenic
1096109906 12:49022415-49022437 TGGGATCAGGTAGGAGACTCAGG + Intronic
1096720383 12:53516914-53516936 GGGGATGATCTATGAGGCTCCGG + Exonic
1100407236 12:94282420-94282442 GGGGATGAGGAAGGAGACACGGG - Intronic
1101544989 12:105704137-105704159 AGGGATGAGGGAGGAGAGACCGG + Intergenic
1101791894 12:107935237-107935259 GGGCATGAGGTAGGTGACAGTGG - Intergenic
1101933331 12:109033849-109033871 AGGGATGAGCTATGTGACCCAGG - Intronic
1102636736 12:114331223-114331245 GGGGATGAGCATGAAGAGACAGG + Intergenic
1102950328 12:117026791-117026813 GGCACTGAGCTAGGAGACACTGG - Intronic
1103536583 12:121637704-121637726 GGGGAGGTGGCAGGAGACACTGG + Intronic
1104973702 12:132542696-132542718 GGGGAGGAGATAGGAGACAGAGG - Intronic
1105685317 13:22775409-22775431 GGGGATGAGCTATGTGATGCTGG + Intergenic
1110233324 13:73189926-73189948 GGAGATGGGCTAGGAAACAATGG - Intergenic
1110827724 13:79992044-79992066 GGAGAAGAGGCAGGAGACACAGG - Intergenic
1112492957 13:99883660-99883682 AGGGGTGTGGTAGGAGACACTGG - Intronic
1115452357 14:33562469-33562491 GGCTATGAGATAGGAGACATGGG + Intronic
1118468932 14:66056883-66056905 GGGGATGGGCAAAGAGGCACTGG + Intergenic
1118478394 14:66140588-66140610 GGGAATGAGCTAGCAGAGAGTGG + Intergenic
1119897663 14:78233515-78233537 GGGGATGACCCAGAAGAGACTGG - Intergenic
1122144864 14:99683391-99683413 CGGGATGGGCAAGGAGACGCGGG + Intergenic
1122930908 14:104932738-104932760 GGGGAGGATGGAGGAGACACTGG - Intronic
1123060261 14:105591229-105591251 TGGGCTGAGCTAGGCTACACTGG - Intergenic
1123060264 14:105591249-105591271 TGGGCTGAGCTAGGCTACACTGG - Intergenic
1123409203 15:20044561-20044583 GGGGGTGAGGAAGGGGACACAGG + Intergenic
1123518534 15:21051269-21051291 GGGGGTGAGGAAGGGGACACAGG + Intergenic
1126994745 15:54428332-54428354 AGGGATGAGCTGGGAGTCAAAGG - Intronic
1128898646 15:71398827-71398849 GGGGATTGGGTAGGAGACAGGGG + Intronic
1129389869 15:75215107-75215129 GGAGAGGAGCTAGGGGATACAGG - Intergenic
1129849020 15:78781247-78781269 GGGGATGGGACAGGAGAGACAGG - Intronic
1129853669 15:78810218-78810240 GGGCATGAGGTTGGAGAGACTGG - Intronic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1134682572 16:16136651-16136673 GGGGGTGAACAAGGAGACACCGG + Intronic
1136871605 16:33812471-33812493 GGGGGTGGGGCAGGAGACACAGG - Intergenic
1137507013 16:49062973-49062995 GGGGAGCAGTTAGGAGACAATGG + Intergenic
1138780411 16:59778390-59778412 GGTGATGAGCTAGGAGGAAAAGG + Intergenic
1140123952 16:72105199-72105221 AGGGAGGAGCTGTGAGACACTGG - Intronic
1140468932 16:75204191-75204213 GGGTATGAGCTTGGCGACACGGG + Exonic
1140472841 16:75224814-75224836 AGGTATGAGCTTGGTGACACGGG - Exonic
1141281564 16:82634090-82634112 TGCGTTCAGCTAGGAGACACAGG - Intronic
1141734106 16:85840824-85840846 GGGGATGGGCTCGGGGACTCTGG - Intergenic
1142201721 16:88764197-88764219 GGGGATGTGCCTTGAGACACGGG + Intronic
1203100567 16_KI270728v1_random:1303587-1303609 GGGGGTGGGGCAGGAGACACAGG + Intergenic
1142466015 17:137850-137872 TGGGCTGGGGTAGGAGACACTGG - Intronic
1144876259 17:18399006-18399028 GGGGTTGGGCCAGGGGACACGGG - Intergenic
1145155969 17:20545414-20545436 GGGGTTGGGCCAGGGGACACGGG + Intergenic
1147134044 17:38425181-38425203 AGGGATGAGGAAGGAAACACAGG - Intergenic
1147419539 17:40315519-40315541 TGGGATGAGCTAGGAGGCTTGGG + Intronic
1147890193 17:43711565-43711587 GGGGCTGAGCTGGGAGTGACAGG - Intergenic
1147966189 17:44195451-44195473 TGGGATCAGCTATGAGACCCTGG - Exonic
1148134933 17:45286143-45286165 GGGAATCAGCCAGGAGCCACTGG - Intronic
1148733693 17:49852576-49852598 GGGGATGAGGTGGGGCACACGGG + Intergenic
1149524945 17:57348236-57348258 GGGGTTGAGTTGGGAGTCACAGG + Intronic
1151712316 17:75813789-75813811 GGGGATGAGTGGGGAGACCCTGG + Exonic
1152135644 17:78501692-78501714 GGGGAAGGGCAAGGGGACACCGG - Intronic
1156346412 18:36260798-36260820 GGTGATGAGCTCAGAGACAGTGG - Intronic
1157056770 18:44238649-44238671 GGGGATGAGAAAGGAGACCATGG + Intergenic
1158482046 18:57830754-57830776 TGGGATGAGGTTGGAGACAGTGG + Intergenic
1158525628 18:58210204-58210226 AGGAATGAGAAAGGAGACACAGG + Intronic
1159894829 18:73986185-73986207 TGTGATGAGAGAGGAGACACAGG - Intergenic
1161250815 19:3279287-3279309 GGGGAGGACCAAGGAGGCACTGG + Intronic
1161633091 19:5369207-5369229 GAGGATGGGGTAGGAGCCACAGG - Intergenic
1162127794 19:8508698-8508720 GGGGGTGGGCTAGGGGACCCTGG + Intergenic
1162897627 19:13774826-13774848 GGGGACGAGCTAGGAGCGAGGGG + Intronic
1162967598 19:14163426-14163448 GGGGAGGAGGTAGGAGAGAAGGG + Intronic
1163090471 19:15016119-15016141 GTGGACGAGGTAGGAGACTCAGG + Intronic
1163749057 19:19064527-19064549 GGCCATGAGTTAGGAGTCACAGG - Intronic
1163835499 19:19571043-19571065 GGGGAGGAACGGGGAGACACAGG + Intronic
1164738240 19:30558302-30558324 GGGGGAGAGCCAGGCGACACGGG + Intronic
1164756964 19:30696751-30696773 GGGGCTGAGCTGGGAGGCATGGG + Intronic
1165116681 19:33533085-33533107 TGGGAGGAGCTAGCAGACCCTGG - Intergenic
1165665193 19:37621982-37622004 AGGGATGAGGCAGGAGCCACTGG + Intronic
1165739370 19:38196311-38196333 GGGGAAGAGCAAGGAGGCCCAGG + Intronic
1166632190 19:44416390-44416412 GGTGATGAGATGGGAGACATAGG - Intergenic
1166636044 19:44452643-44452665 GGAGGGGAGCTGGGAGACACAGG + Intergenic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1166638619 19:44473999-44474021 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1167354289 19:48993681-48993703 GAGGAGGAGCCAGGAGACATTGG + Exonic
1167552374 19:50169947-50169969 GGGGCAGAGATAGGAGACAGGGG - Intergenic
1167746174 19:51353090-51353112 AGGGATGAGCAAGGGGGCACAGG + Intronic
1167958106 19:53084197-53084219 GGGGTTGAGCTGGCAGCCACTGG - Intronic
1168270837 19:55248899-55248921 GTGGATGAGCAAGGAGATCCTGG - Intronic
1202648952 1_KI270706v1_random:163443-163465 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1202649307 1_KI270706v1_random:166146-166168 GGAGAGTAGCTGGGAGACACAGG - Intergenic
925022145 2:579621-579643 GGGGATGAGACGGGAGACGCGGG - Intergenic
925545225 2:5008774-5008796 GGGAATGAGGTAGGAGAGAATGG + Intergenic
926035469 2:9632115-9632137 GGGGAAGTGCAAGGAGAGACAGG - Intergenic
926106546 2:10155705-10155727 GGGCCTGACCTGGGAGACACTGG + Intronic
926170875 2:10551901-10551923 GGGCATGAGGCAGGAGAGACTGG - Intergenic
926572756 2:14547348-14547370 GGAGATCCGCTAGGAGGCACGGG + Intergenic
927790048 2:26002679-26002701 GGAGGTGAGCTAGGGGGCACGGG + Intergenic
927810643 2:26178736-26178758 GAGGAAGAGCTAGGAGCCCCCGG - Intronic
927851807 2:26504223-26504245 GAGGATGAGCGTGGGGACACTGG - Intronic
927974710 2:27329416-27329438 GGTCATGGGCTAGGAAACACTGG + Exonic
932414569 2:71565809-71565831 AGGGTTGAGTTAGGTGACACAGG + Intronic
932791395 2:74656805-74656827 GGGGGTGAGTTGGGAGACATGGG + Intronic
933174114 2:79157523-79157545 GGGGATGAGATGGAAAACACTGG + Intronic
933678306 2:85077144-85077166 GGGGCTGAGATGGGAGCCACTGG + Intergenic
934730137 2:96651146-96651168 GGAGATGGACTTGGAGACACAGG - Intergenic
934992361 2:98930493-98930515 GGGGATGGAGTAGGGGACACAGG - Intronic
935085305 2:99838870-99838892 AGGAATGAGCTGGCAGACACAGG - Intronic
936486335 2:112929005-112929027 CGGGATGTGCTTGGAGACAGAGG + Intergenic
937243589 2:120477994-120478016 GGGGATGAGGCAGGGGACAGAGG - Intergenic
937782606 2:125856207-125856229 AGGCATGAGCCAGGACACACGGG + Intergenic
938103589 2:128514529-128514551 GGGGTGGAGGTGGGAGACACAGG - Intergenic
938540860 2:132282423-132282445 GGAGAGTAGCTGGGAGACACGGG + Intergenic
938541376 2:132286568-132286590 GGAGAGAAGCTGGGAGACACAGG + Intergenic
938541680 2:132288326-132288348 GGAGAGTAGCTGGGAGACACGGG + Intergenic
940274830 2:151928421-151928443 AGGGATGTCCTAGGAGGCACAGG - Intronic
941099629 2:161281926-161281948 GGAGAGTAGCTGGGAGACACAGG - Intergenic
941099658 2:161282073-161282095 GGAGAGAAGCTGGGAGACACAGG - Intergenic
941601749 2:167551329-167551351 GAAGATGAGCTAGGAGGCATTGG + Intergenic
942667950 2:178342028-178342050 GGGTATGAGGTAGGAGAAAGTGG - Intronic
943912150 2:193583277-193583299 GGGGAGAAGCCAGGAGACAATGG + Intergenic
946083932 2:217151974-217151996 GGGAATGAGCAAGGCAACACTGG + Intergenic
946502604 2:220265598-220265620 GGACATGAGCCAGGGGACACAGG + Intergenic
946841620 2:223825520-223825542 GGGGAGGAGATGGGAGAGACAGG - Intronic
947691578 2:232141739-232141761 GGTGAAAAGCTAGGAGACAAAGG - Intronic
948143528 2:235691830-235691852 AGGGATGAGCTTGGGGACAATGG + Intronic
948541441 2:238693912-238693934 GGGGATGAGACAGGAGACCAGGG - Intergenic
1169192263 20:3665907-3665929 CAGGATGAGATAGGAGATACAGG - Intergenic
1169532126 20:6496610-6496632 GGGGGTGAGATAGGAGAAAAAGG - Intergenic
1171869767 20:30515424-30515446 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1171870277 20:30519590-30519612 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1171870553 20:30521202-30521224 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1172126073 20:32626103-32626125 GAGAATGAGGTAGGAGACACAGG - Intergenic
1172829468 20:37820998-37821020 GGGGATGAGCAAGGTGGTACCGG - Intronic
1173304130 20:41831693-41831715 GGGGATGAAGTAGAAGAAACAGG + Intergenic
1174270872 20:49367386-49367408 GGAGATGAGCTAGCAGATTCGGG + Exonic
1175352232 20:58331917-58331939 GGGGATGACCGAGGAGAAAGAGG - Intronic
1175577774 20:60075489-60075511 TGGGAAGAGCTGGGAGCCACGGG - Intergenic
1175632758 20:60556105-60556127 GGGGCTGAGCTTGGGGACCCAGG + Intergenic
1176602867 21:8809099-8809121 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1176963039 21:15181055-15181077 GGGGTTGAACAATGAGACACAGG - Intergenic
1178487287 21:33027061-33027083 GGGGACAAGCTAGGAGGCAGTGG + Exonic
1178832818 21:36070497-36070519 AGGGAGGAGCTAGGAGATGCAGG + Intronic
1180197689 21:46207458-46207480 GGGGATGTGCTCGGTGACATGGG + Exonic
1180345152 22:11700656-11700678 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1183029459 22:35092546-35092568 GGGGAAGTGTTAGGAGACCCAGG - Intergenic
1183456006 22:37923772-37923794 GTGGATGGGCCAGGACACACAGG - Intronic
1184024818 22:41847434-41847456 GGTGAAGAGCTGGGAGATACAGG + Intronic
1184231147 22:43159134-43159156 GGGGATGCTGGAGGAGACACGGG + Intronic
1184253849 22:43276111-43276133 GGGGACGCGCTAGGAAGCACAGG + Intronic
1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG + Intronic
1184746230 22:46457842-46457864 GGTGCTGAGCTAGGAGGAACCGG - Intronic
1185064571 22:48624705-48624727 CAGGATGAGCCAGGAGTCACTGG - Intronic
1185175279 22:49322886-49322908 GGGGATGAGCTCGGGGCCATGGG + Intergenic
952249279 3:31634226-31634248 AGGCATGAGGTAGGAGAAACTGG + Intronic
953447877 3:42983011-42983033 GGGGAAGAACTAGGAGACCCGGG - Intronic
954609334 3:51936073-51936095 GGGGAGGAGCTGGGGGAGACCGG - Intronic
954898585 3:53998713-53998735 GGGGATGAGCTTGGTGGCAGGGG + Intergenic
961143547 3:124575379-124575401 GGAAATGAGACAGGAGACACTGG - Intronic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
963087431 3:141451205-141451227 GGAGATGAGATAGGAGACTGTGG + Intergenic
963846834 3:150167787-150167809 GGGGGTTAGCTTGGAGACACTGG - Intergenic
963872292 3:150430404-150430426 GGGGATGAGATAGGAATTACAGG + Intronic
964621968 3:158727624-158727646 GGGGATGATCCAGGAAACCCTGG + Intronic
967595821 3:191326035-191326057 GCTGATGAGCTAGGAAGCACTGG + Intronic
967770231 3:193326250-193326272 GGGAAGGAGCTAGAAGCCACAGG + Intronic
973375162 4:49281261-49281283 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973376062 4:49287283-49287305 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973376985 4:49293446-49293468 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973378848 4:49305881-49305903 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973379370 4:49309773-49309795 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973379682 4:49311534-49311556 GGAGAGAAGCTGGGAGACACAGG - Intergenic
973380241 4:49315769-49315791 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973381161 4:49321935-49321957 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973382249 4:49328980-49329002 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973385784 4:49513592-49513614 GGAGAGTAGCTGGGAGACACAGG - Intergenic
974829012 4:67167547-67167569 GGCGATGAGCTCTGACACACAGG - Intergenic
976053291 4:81032285-81032307 TGGGAGGAGCTGGGAGACAAGGG + Intronic
976097314 4:81522889-81522911 GGGGATGAGGTGGAAGAAACGGG + Intronic
978168969 4:105645774-105645796 GGGGAAGATCTAGGTGACAGAGG + Intronic
978556565 4:109987394-109987416 GGGGCTGAGGTAGGAGAATCAGG - Intronic
982531093 4:156544987-156545009 GGGGATTAGGAAGGAAACACAGG - Intergenic
982931947 4:161419700-161419722 GGAGATGAGTTTGGAGAGACAGG - Intronic
985872168 5:2565500-2565522 GGGGAGGAGCCAGGAGAAGCTGG - Intergenic
986181227 5:5394728-5394750 TTGCATGAGCTAGGAGTCACTGG - Intergenic
986684643 5:10265749-10265771 GGGGATGAGCTGGGCCACTCTGG - Exonic
988884889 5:35545883-35545905 GGAGATGACCTTGGAGAGACAGG - Intergenic
990383273 5:55235397-55235419 GGAGACGAGCTAAGAAACACTGG + Intergenic
991010821 5:61881487-61881509 GGGGATAAGCTAGGAATCAGAGG - Intergenic
991498864 5:67255889-67255911 GCAGATGAGGTAGGAGACTCAGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
995857158 5:116605486-116605508 GGTGAGGAGGTTGGAGACACTGG + Intergenic
997893692 5:137697016-137697038 GGAGATGAGCATGGAGGCACTGG - Intronic
1001318725 5:170663058-170663080 GGGGATGGGGAAGAAGACACTGG + Intronic
1001329429 5:170751966-170751988 GAGGATGAGTTAGGACACCCGGG + Intergenic
1001491189 5:172156588-172156610 GGGGCTGAGCTGGGACAGACAGG + Intronic
1003127455 6:3366854-3366876 GAGGATGGGGTAGGAGACAGAGG - Intronic
1003693662 6:8380036-8380058 AGTGATGAGGTTGGAGACACAGG + Intergenic
1005899846 6:30207688-30207710 GGAAATGAGCCTGGAGACACAGG - Intronic
1006772684 6:36566735-36566757 AAGGATGAGGTAGGAGAAACGGG - Intergenic
1009021326 6:57950719-57950741 TTGCATGAGCTAGGAGTCACTGG - Intergenic
1009887401 6:69640046-69640068 AGTGATGAGGTAGGAGACACAGG + Intergenic
1012868039 6:104641415-104641437 GGAGACCAGCTAGGAAACACAGG + Intergenic
1013159435 6:107527452-107527474 GGGGATGTGATTGGAGAGACTGG + Intronic
1014219757 6:118788142-118788164 GGAGATGGGCTAAGAGATACAGG + Intergenic
1016049387 6:139514477-139514499 GGTGATGATCCAGGAGAGACAGG - Intergenic
1018279809 6:162173031-162173053 GGGGATGGGGAAGGAGAAACTGG + Intronic
1019130448 6:169869339-169869361 GGGGAAGAGCGAGGAGACATGGG - Intergenic
1019287199 7:229559-229581 GGGGATGAGCAAGGTGCCAGGGG + Intronic
1021687964 7:23206017-23206039 GGAGATGAGCTAGGGGGCCCCGG + Intergenic
1021955716 7:25822687-25822709 GGGGAGGAGGTAGGAGCCCCTGG - Intergenic
1022421364 7:30226570-30226592 GGTGATGAGCAAGGAAAGACAGG + Intergenic
1022557366 7:31311873-31311895 GGGGATCACCAGGGAGACACAGG - Intergenic
1022810109 7:33860255-33860277 GGGTGTGAGCTGGGAGACTCAGG - Intergenic
1026159101 7:67852981-67853003 GGGGATGAGGGAGGAGAAGCAGG + Intergenic
1026895407 7:74007429-74007451 GGGGATGGGGCAGCAGACACTGG - Intergenic
1027234119 7:76287588-76287610 GGGGTAGAGGGAGGAGACACAGG + Intergenic
1029495830 7:100895220-100895242 GGGGCTGGGCTAGGAGTGACCGG - Intronic
1029921413 7:104268714-104268736 GGGGAAGAGCTGGGAGAGAAAGG - Intergenic
1032023252 7:128421705-128421727 GGGGATCAGCCAAGAGACCCAGG - Intergenic
1034272821 7:149811667-149811689 GGCGATGAGCCCGGAGACACAGG - Intergenic
1034277353 7:149829675-149829697 GGGGATGACTGAGGGGACACAGG - Intergenic
1035559903 8:596453-596475 GGTGAGGAGCAGGGAGACACAGG + Intergenic
1036183402 8:6604131-6604153 GGGGCTGAGCTAGATGAGACAGG - Intronic
1036578291 8:10049279-10049301 TGGGAAGAGCTAGGAAATACAGG - Intergenic
1036887500 8:12569536-12569558 AGGGAGGGGATAGGAGACACTGG + Intergenic
1036895101 8:12627636-12627658 AGGGAGGGGATAGGAGACACTGG + Intergenic
1037478138 8:19277728-19277750 GGGGAAGAGCTATCAGACAAAGG - Intergenic
1038613935 8:29076004-29076026 GGGGAGGAGGTAAGAGCCACAGG + Intronic
1040509868 8:48084339-48084361 GGAGAGGAGCTGGGAGACATGGG + Intergenic
1040509909 8:48084477-48084499 GGAGAGGAGCTGGGAGGCACTGG + Intergenic
1040509960 8:48084773-48084795 GGGGAGTAGCTGGGAGAGACAGG + Intergenic
1041263856 8:56045192-56045214 GGGAATGAGCTAGGAGAGGAGGG - Intergenic
1042161372 8:65899289-65899311 GAGAATGGGCCAGGAGACACAGG - Intergenic
1042209616 8:66366721-66366743 GGGGATGTGCTTGGAGATATTGG - Intergenic
1047470512 8:125167040-125167062 GGAGATGAGGTGGGAGACAGTGG - Intronic
1049479605 8:142815588-142815610 GGGCATGAGCCGGGAGGCACCGG + Intergenic
1049700553 8:144009632-144009654 GGAGATGAGCCAGGAGGCAGGGG - Intronic
1051501490 9:17782803-17782825 GGGGAAGAGCAAGGAAAAACTGG + Intronic
1051838098 9:21363411-21363433 AGGGATGAGTCAGGAGACCCTGG + Intergenic
1052973253 9:34392724-34392746 GGGGAAGAGCAAGGACAAACTGG + Intronic
1057058024 9:91978718-91978740 GTGGGTGAGCCAGGAGAAACCGG - Intergenic
1059293733 9:113250929-113250951 GGGCATGTGCAAAGAGACACGGG - Intronic
1059743989 9:117182434-117182456 AAGGATGACCCAGGAGACACAGG + Intronic
1060494761 9:124110428-124110450 GCCGATGAACTTGGAGACACGGG + Intergenic
1060548713 9:124475394-124475416 GGGGATGGGGTAGGAGGCTCCGG + Intronic
1062287056 9:135777997-135778019 TGGGAGGAGCTGGGAGCCACAGG - Intronic
1062700914 9:137902328-137902350 GGGGAGGGGCTAGGAGCCAGTGG - Intronic
1203698879 Un_GL000214v1:119510-119532 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203699836 Un_GL000214v1:125808-125830 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203700738 Un_GL000214v1:131800-131822 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203479572 Un_GL000224v1:398-420 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203480539 Un_GL000224v1:6694-6716 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203481506 Un_GL000224v1:13022-13044 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203482469 Un_GL000224v1:19331-19353 GGAGAGTAGCTTGGAGACACAGG + Intergenic
1203549058 Un_KI270743v1:153195-153217 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203549392 Un_KI270743v1:155354-155376 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203550350 Un_KI270743v1:161666-161688 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203569176 Un_KI270744v1:115756-115778 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203570125 Un_KI270744v1:122045-122067 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1185612853 X:1402649-1402671 GGGGAGGAGCGAGGAGAAAGAGG - Intergenic
1187116279 X:16355186-16355208 GGGCAAGAGCCAGGAGACCCTGG + Intergenic
1193553212 X:82924577-82924599 TGGGATGGGCTAGCAGACAGGGG + Intergenic
1193590232 X:83380522-83380544 GAGGATGAGCTAAGAAAGACTGG - Intergenic
1196031430 X:111098059-111098081 GGTTATAAGCTAGGGGACACAGG + Intronic
1196225199 X:113157991-113158013 GGGGAAAAGCTAGCAGTCACAGG + Intergenic
1196784241 X:119408171-119408193 GGAGATGAGGTAGGACAAACTGG - Intronic
1200024544 X:153245812-153245834 GGTGATAAGCTAGGAGGCAATGG + Intergenic
1200169500 X:154062068-154062090 TGGGAGGGGCTAGGAGAGACCGG + Intronic
1200204797 X:154308165-154308187 GTGGAGGAGGTAGGAGGCACTGG + Intronic
1200254038 X:154569781-154569803 GGGAGTCAGCTCGGAGACACAGG - Intergenic
1200263731 X:154634627-154634649 GGGAGTCAGCTCGGAGACACAGG + Intergenic
1201613166 Y:15865741-15865763 GAGAATGAGCTTGGAGCCACAGG - Intergenic