ID: 905412204

View in Genome Browser
Species Human (GRCh38)
Location 1:37778458-37778480
Sequence TGATCCTCTGGGCTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905412204_905412207 5 Left 905412204 1:37778458-37778480 CCACAAGGAAGCCCAGAGGATCA 0: 1
1: 0
2: 3
3: 21
4: 214
Right 905412207 1:37778486-37778508 AGCAAACATACCAAGCTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905412204 Original CRISPR TGATCCTCTGGGCTTCCTTG TGG (reversed) Intergenic
900687016 1:3955018-3955040 GGATCATCTGGGCTTCCCCGGGG - Intergenic
900751364 1:4399973-4399995 TGATCGGCTGTGCTTCCTTTTGG + Intergenic
901949000 1:12726441-12726463 TGATGCTCTGGGCTGCTGTGAGG + Exonic
904546796 1:31280617-31280639 CTTTCCTCTTGGCTTCCTTGGGG - Intronic
904602881 1:31683490-31683512 TGACCCTCAGGGTCTCCTTGGGG - Intronic
905412204 1:37778458-37778480 TGATCCTCTGGGCTTCCTTGTGG - Intergenic
905540337 1:38755585-38755607 TGATCCTCTGGGGAACTTTGGGG - Intergenic
906706927 1:47901761-47901783 TTAGACCCTGGGCTTCCTTGAGG - Intronic
907340425 1:53731422-53731444 CCTTCCTTTGGGCTTCCTTGGGG + Intronic
909246554 1:73292504-73292526 TCAACATTTGGGCTTCCTTGGGG + Intergenic
910219029 1:84871732-84871754 TGAACCTCTGGGATTTCATGTGG - Intronic
910680023 1:89853444-89853466 TGATCCTTTGGCCATCCCTGTGG - Intronic
912243807 1:107939865-107939887 TCCTCCTCTGGGCTTCTTTCTGG - Intronic
912700588 1:111875535-111875557 TGATCCTCAGGGTCCCCTTGGGG - Intronic
913584981 1:120266074-120266096 AGATCCTTTTGGCTTCCTTATGG + Intergenic
913623201 1:120632288-120632310 AGATCCTTTTGGCTTCCTTATGG - Intergenic
914566984 1:148877931-148877953 AGATCCTTTTGGCTTCCTTATGG + Intronic
914605840 1:149252311-149252333 AGATCCTTTTGGCTTCCTTATGG - Intergenic
914737295 1:150430052-150430074 TTAACCTATGGGATTCCTTGTGG - Intronic
915404589 1:155649985-155650007 TGAGTCTTTGGGCTTCCCTGGGG + Intergenic
915917494 1:159949834-159949856 TGGTTCTCTGGGCTTCCCTTAGG - Intergenic
920435954 1:205947352-205947374 TGAGCCCCTGGGCTTCCCAGGGG - Intergenic
922693378 1:227712149-227712171 TGAACCTGTGGGTTTTCTTGGGG + Intergenic
924583724 1:245343973-245343995 AGAATCTCTGGGCTTTCTTGGGG + Intronic
1068605593 10:59001802-59001824 TTAAACTCTGGGCTTCCTTCAGG + Intergenic
1068705539 10:60071429-60071451 TCATCTTCTGGACTACCTTGGGG + Exonic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1073355453 10:102850314-102850336 TGATCCTCTTCTCTTCCTTGTGG - Intergenic
1073385490 10:103124003-103124025 TGTTGCTCTAGTCTTCCTTGGGG + Intronic
1074215275 10:111378156-111378178 AGATCCTATGGGCTTCCTTCTGG - Intergenic
1074979019 10:118604337-118604359 TGTTCCTATATGCTTCCTTGGGG + Intergenic
1076451424 10:130559682-130559704 TGAGCATCTGGGCTTCCAGGAGG + Intergenic
1076468552 10:130702709-130702731 TGTTCCTCTGGCCTTCCTGATGG + Intergenic
1076826948 10:132973920-132973942 TGATCCCTTGGGCGTCCCTGTGG - Intergenic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1081664513 11:44908931-44908953 TGAGCCTTTTAGCTTCCTTGTGG - Intronic
1081802232 11:45867955-45867977 TGATGGTCTGGGCTTCATTCTGG - Intronic
1083222804 11:61264598-61264620 AGATGCTCTGGGCTTCCTCATGG - Intronic
1084007511 11:66331175-66331197 GCCTGCTCTGGGCTTCCTTGGGG + Intronic
1085042082 11:73332516-73332538 TGAATCTCTGGGCTTTCCTGTGG + Intronic
1087994194 11:104783089-104783111 TGATTTTCTGAGCTTCCTTTGGG + Intergenic
1088623957 11:111715206-111715228 ACATCCTCCGGGCTTCTTTGTGG + Intronic
1090333961 11:125950666-125950688 GGGGCCTCTGGGATTCCTTGGGG + Intergenic
1090839798 11:130477912-130477934 AGGTCCTCTGGGCTGCTTTGGGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091090356 11:132765080-132765102 AGATCCTGTGGCCTTTCTTGGGG - Intronic
1093535612 12:20219290-20219312 TGGTCCTCTGGGCCTTCTTGTGG + Intergenic
1093929052 12:24936948-24936970 TGAGGCTATGGGCATCCTTGGGG + Intronic
1096197092 12:49655730-49655752 TGAGCCTCTGGGCTTCAAGGAGG + Intronic
1096215087 12:49794076-49794098 TGTTCCTCTGGGGTTCCCTAAGG - Intronic
1098496588 12:71142770-71142792 TGATCCTCTGGGCTCCCTAAGGG + Intronic
1098946699 12:76597884-76597906 TCATCCTCTGTGTTTCCTTTAGG - Intergenic
1101217667 12:102600917-102600939 TAATCTTCTGGGCCTCTTTGGGG + Intergenic
1101320692 12:103670569-103670591 TGACCCTCTGGGACTCCTCGTGG - Intronic
1103051653 12:117785011-117785033 TGAGACTCTGGGTTTCCTTCTGG - Intronic
1103085542 12:118060248-118060270 TGTTCATCTGGGCTGGCTTGAGG + Intronic
1103621067 12:122187643-122187665 TGATCCTCAGCGCTGACTTGGGG + Intronic
1104064689 12:125297123-125297145 AGAGACTCTGGGTTTCCTTGGGG + Intronic
1104610571 12:130224600-130224622 ACATCCTCTGGTCTTCCTCGAGG + Intergenic
1109530533 13:63638420-63638442 TGATCATTTGGGGTTCCTTGTGG + Intergenic
1114923132 14:27359878-27359900 TGATCAACTGGGCTTCATCGCGG - Intergenic
1119128814 14:72153177-72153199 AGATCATCTGGGCTTCAGTGAGG - Intronic
1122424350 14:101597024-101597046 TGACCCCCTGGGCTTCCTGCAGG - Intergenic
1123480735 15:20628949-20628971 TGACCCACTGGACTTCCTGGGGG - Intergenic
1123637275 15:22371418-22371440 TGACCCACTGGACTTCCTGGGGG + Intergenic
1123802648 15:23837515-23837537 TGCTCAGCTGGGTTTCCTTGTGG + Intergenic
1127574157 15:60273640-60273662 GGATTCCCTGGGCTTCCTTAGGG + Intergenic
1127973631 15:63981248-63981270 TGATGCACTGGGCTGCCTTGGGG + Intronic
1128092262 15:64926945-64926967 GGATGCTCTGGACTTCCTCGTGG + Exonic
1128256291 15:66199505-66199527 GGAGCCTCTGGGCTGGCTTGGGG - Intronic
1131944087 15:97600092-97600114 TGATCAACTGGGCTTCATTTCGG - Intergenic
1132339600 15:101069493-101069515 TGTGCCTCTGGGCTTGCTGGCGG - Exonic
1132601021 16:773017-773039 TGATCCTCCGGGAGGCCTTGTGG + Exonic
1134226381 16:12394278-12394300 TGATCTTCTGGGCATCCCAGAGG + Intronic
1134411222 16:14004354-14004376 TGGACCTCTGGGATCCCTTGAGG - Intergenic
1135815474 16:25628566-25628588 TGAACCTCTGGCCTTCAGTGGGG - Intergenic
1135889887 16:26347587-26347609 TGTTCCTGGGGGCTTCCCTGTGG + Intergenic
1136775797 16:32871151-32871173 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1136894820 16:33990361-33990383 CGCTCCTCTGGACTTCCCTGCGG + Intergenic
1137597332 16:49733682-49733704 TCATCCTCTGGGCTCCCAAGGGG + Intronic
1138266235 16:55661824-55661846 TAAGACTCTGAGCTTCCTTGGGG - Intronic
1139605954 16:68018652-68018674 TGATCCGCAGGGCTTCATTTGGG + Intronic
1203078213 16_KI270728v1_random:1133260-1133282 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1143564578 17:7713886-7713908 TGATGCTCTGAGCTTTTTTGGGG + Intergenic
1145906724 17:28520474-28520496 TGGTCCTCTGGGATTCCTCTGGG - Intronic
1147600467 17:41742097-41742119 GGATGCTCTGGGCTTCCTGGAGG - Intergenic
1149313934 17:55421696-55421718 TGATCCTCTGCTCCTCCTCGGGG + Exonic
1149616494 17:58005451-58005473 TGATCCTCTGCTTCTCCTTGGGG + Exonic
1151930995 17:77231224-77231246 TGATCCTCAGGGATTCCTGCAGG + Intergenic
1152287751 17:79422425-79422447 TGACCCCCTGGGCTTCCTGGAGG - Intronic
1152561922 17:81082917-81082939 TGCTCATCTGGGCGGCCTTGTGG + Intronic
1153676092 18:7456906-7456928 TGTTCCTCTGAGCATCCTTGAGG + Intergenic
1157097554 18:44700123-44700145 TGAGCGTTTGGGCTTCCTTTTGG + Intronic
1157184238 18:45524510-45524532 GGCTGCTCTGGGCTTCCTTGAGG - Intronic
1160662662 19:308349-308371 TTACCCTCTGGGCTTGCTGGAGG - Intronic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1161618512 19:5286080-5286102 TGGTCCCATGGGCCTCCTTGTGG - Exonic
1163462065 19:17444940-17444962 TGGTCCTATGGGCTTTCATGAGG + Intronic
1164751378 19:30657537-30657559 TGCTCTTCTGGCCCTCCTTGGGG + Intronic
1165334796 19:35162208-35162230 TGAGCCTCTGGGTTGCCTAGAGG + Intronic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1166658132 19:44627214-44627236 AGATCCTCCTGGCTTCCATGTGG + Intronic
1166791761 19:45402856-45402878 GGATCCTGTGGACTTCCTGGAGG + Intronic
1167464950 19:49645779-49645801 GGCTGCGCTGGGCTTCCTTGGGG + Intronic
1167557552 19:50205548-50205570 AGATCCTCGGGGCTACCTGGGGG - Intronic
1167916674 19:52745517-52745539 TGATCCTTTGGGATTTTTTGGGG + Intergenic
925070846 2:965490-965512 TGATCCTCTGGTCTTCTTCAGGG + Intronic
925071626 2:973488-973510 GGATTCTCTGGGCTTCTTGGGGG + Intronic
926977561 2:18530622-18530644 TGATCCAATGGGCTTCAGTGGGG - Intergenic
927972285 2:27313211-27313233 TGAACCCCAGGGCTTCATTGTGG + Intronic
928171165 2:29003737-29003759 AGATCCACTGGGGCTCCTTGTGG + Intronic
928196842 2:29222345-29222367 TGATGATCAGGGCTTCCATGAGG + Exonic
929824431 2:45299318-45299340 GGATCCTCTGACCTTCCTTGAGG + Intergenic
931597376 2:63963577-63963599 TGATACTCTGTGTTTCCTTAGGG - Intronic
933115649 2:78467329-78467351 TGATCCTCTAGGATGCCTTAAGG + Intergenic
935623708 2:105150898-105150920 TGAGCCTCTGGGCTGCATTCAGG + Intergenic
936678105 2:114738912-114738934 TGGGCTTCTGGGCTTCCATGAGG - Intronic
937239846 2:120453031-120453053 TGAAGCCCTGGGATTCCTTGTGG + Intergenic
937433447 2:121860418-121860440 GGAGCCTGTGGGTTTCCTTGAGG - Intergenic
937851727 2:126642204-126642226 CCTTCCTCTGGGCTTCCTTTGGG + Intergenic
938112962 2:128581429-128581451 ACCTCCTCTGGGCTGCCTTGTGG + Intergenic
938556525 2:132429758-132429780 TGATTCTCTGGCCCTCCTAGGGG + Intronic
939323706 2:140658732-140658754 TGACCCTTTGGGGTTCTTTGCGG + Intronic
939878943 2:147608328-147608350 TGATCCTCTGCCCTTCCTGGGGG - Intergenic
940804474 2:158170745-158170767 TGATCCTCTGGACATCAGTGTGG + Intergenic
942669866 2:178363689-178363711 TGATCAACTGTGCTTCCTTGGGG + Intronic
944639301 2:201706853-201706875 TGCTCTCCTGGGCTTTCTTGGGG - Exonic
945576858 2:211542045-211542067 TGATTTTCTGGGCTTCTTTTTGG + Intronic
947001904 2:225466370-225466392 TGAGCATTTGGGCTTACTTGGGG + Intronic
948143870 2:235693856-235693878 TGATCCTCAGCCCTTACTTGGGG + Intronic
948266082 2:236636141-236636163 TGACCCTCTGGCCTTTCTTGGGG - Intergenic
948301246 2:236909022-236909044 TGATCCTGGGGGCGTCCATGTGG - Intergenic
1168964344 20:1890234-1890256 TGATGATCTGTGCTTCCTTCGGG - Intergenic
1169526537 20:6433122-6433144 TGATCCTCTGGCCTCCCTGATGG - Intergenic
1170930047 20:20761500-20761522 TGGCCCTCTGGGTTTCCTTTGGG + Intergenic
1171169744 20:23005200-23005222 GGGTCCACTGGGCTTCCATGTGG + Intergenic
1174074182 20:47920513-47920535 TCTTCCCCTGGGCTTTCTTGAGG + Intergenic
1174446930 20:50596788-50596810 TGAGCCTCTGCTCTTCCATGTGG + Intronic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1176120790 20:63453681-63453703 TAATCCTGTGGGCTTCCCGGAGG + Intronic
1176266923 20:64214490-64214512 TGAGCCTCTGGCCTTATTTGTGG - Intronic
1178837092 21:36107975-36107997 GGATCCTATGGGCTTCTTTAAGG + Intergenic
1179988729 21:44934829-44934851 TGATCCTCTGGACATCCCTGGGG - Exonic
1180160331 21:45996285-45996307 TGAGCTTCTGGACCTCCTTGAGG + Intronic
1181166062 22:20983704-20983726 TGGTCCTGTAGGCCTCCTTGGGG + Intronic
1181636828 22:24178376-24178398 TCCTCCTCTGGGCTCCCATGTGG - Exonic
1181913810 22:26263022-26263044 TGCTCCTGGGGGCTTCTTTGTGG - Intronic
1183828777 22:40407181-40407203 TGGTTCTCTGGGCCTCCTAGGGG + Exonic
1184955462 22:47883334-47883356 TGATCCTCTGGGTTACAATGCGG + Intergenic
1184986579 22:48140142-48140164 TCATCCTCTGGGCATCTTTGCGG + Intergenic
949626570 3:5874067-5874089 TGAGCCTCTGGCCTTTCCTGTGG + Intergenic
953435612 3:42874962-42874984 TGATGCTCTGGGCCTCCCAGGGG - Exonic
953892531 3:46763753-46763775 TCAACTTCTGGGCTTCCTAGTGG - Intronic
954640709 3:52096138-52096160 TTATCCTCTGTGCAACCTTGGGG - Intronic
962154640 3:132933166-132933188 TAATTCCCTGGGCTTCCATGAGG + Intergenic
963895593 3:150682351-150682373 AGAGCCTCTGGGCCTCTTTGTGG - Intronic
964421020 3:156502770-156502792 TGATCCTCTTAGCATCCTGGGGG - Intronic
964698071 3:159532646-159532668 TAATACTCTAGGCTTTCTTGGGG + Intronic
965683130 3:171272751-171272773 TGTTCCTCTGTGTTTTCTTGAGG + Intronic
967533861 3:190579696-190579718 TAATCCTCAGGGCTTCGTTTTGG - Intronic
967868916 3:194213340-194213362 TGAGCCTCTGGGCTTTCTTTGGG - Intergenic
968089476 3:195891556-195891578 TGTGCCTCTGGGCTTGCTTCCGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968958197 4:3729870-3729892 CCATCCTCTGAGCTTCCTGGGGG - Intergenic
971573622 4:28245999-28246021 TGAACCTGTGGGTTTCCTAGAGG - Intergenic
972720267 4:41689552-41689574 TCTTCCTGTGGGCTTCCTTTGGG + Exonic
974468788 4:62292442-62292464 CCATCCCCTGGGTTTCCTTGTGG + Intergenic
975766832 4:77677279-77677301 TGTTCCTCTGGGCTTACATTAGG - Intergenic
976128245 4:81856110-81856132 TGAGCCTCAGAGCTACCTTGAGG + Intronic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
982754422 4:159201815-159201837 TGGCCCTCTGGAGTTCCTTGTGG + Intronic
985787778 5:1908671-1908693 TGTTCCTCTGGTCTTCCTTTTGG + Intergenic
987820832 5:22964241-22964263 TGATCCTCTGTGTTTCTGTGAGG - Intergenic
992124662 5:73627321-73627343 TGATCATTTGGGGTTCCATGGGG + Intronic
992679601 5:79140937-79140959 TGTTTCTCTGGGCTTCCTCAGGG - Intronic
995546467 5:113237034-113237056 TGATCCACTGGAAGTCCTTGGGG + Intronic
997625375 5:135327427-135327449 TGAGAGTCTGGGCTTCCTTCTGG - Intronic
998514214 5:142737996-142738018 AAATCCTGTGGGCTTCCTAGTGG - Intergenic
998769522 5:145526059-145526081 TGGTGCTCTGGGCTTCCCTGCGG - Intronic
1000107406 5:158073282-158073304 TAATCTTCTCGGCTCCCTTGAGG + Intergenic
1001720491 5:173852973-173852995 TTGTCCTCTGGGCTTCCTGCTGG - Intergenic
1002779823 6:357531-357553 TGATTCTCTGGAATACCTTGGGG + Intergenic
1004165461 6:13252908-13252930 TGAGCATCTGAGATTCCTTGGGG + Intronic
1004868379 6:19877005-19877027 AGATGCTCAGGGCTTCCTGGGGG - Intergenic
1005222863 6:23607821-23607843 TGTTCCTCTATGTTTCCTTGTGG - Intergenic
1009506459 6:64486729-64486751 TGACCCTTTAGGGTTCCTTGGGG - Intronic
1009514182 6:64593284-64593306 TGCTCCATTGGGCTTCTTTGTGG - Exonic
1011949824 6:92952067-92952089 TGACCCCTTGGGCTTCCTGGGGG - Intergenic
1012758565 6:103264782-103264804 TGAACTTCTGGACTTTCTTGTGG - Intergenic
1012804683 6:103879039-103879061 TGAACCTCTGGGATTCCTCTGGG + Intergenic
1014007588 6:116437826-116437848 TGATGGTGTGAGCTTCCTTGGGG + Exonic
1015190379 6:130465450-130465472 TGATACTTTGGGCTTCTGTGAGG + Intergenic
1019550068 7:1597756-1597778 TGATCCTCAGAGCTTCCAGGGGG + Intergenic
1019605460 7:1907877-1907899 TGATCTTTTGGGTGTCCTTGCGG - Intronic
1020169954 7:5837500-5837522 TGGGGCTCTGGGCTTCTTTGTGG + Intergenic
1020313865 7:6890462-6890484 GGCTCCTCTGGGCTTGCCTGTGG - Intergenic
1022191005 7:28016755-28016777 CGATCCCCTGGGCTGCCTTTTGG - Intronic
1024055788 7:45659122-45659144 TGCTCCTCTGGGGATCCTGGTGG + Intronic
1024226297 7:47328726-47328748 AGGTCCCCTGGGCTGCCTTGAGG - Intronic
1024632037 7:51257075-51257097 TGAGGCTCTGAGCTTCCTAGCGG + Intronic
1026913031 7:74103463-74103485 TGATCCTCTGTCCTTCCGAGTGG + Intronic
1028015213 7:85701563-85701585 TGAGCCTCTAGGTATCCTTGTGG - Intergenic
1029167490 7:98603290-98603312 TGCTCATCTGTTCTTCCTTGCGG + Intergenic
1029557633 7:101281365-101281387 TCATTCTCTGAGCTTCCATGGGG - Intergenic
1031055496 7:116988917-116988939 TGATGCTCTAGGCTCCCTAGAGG + Intronic
1032542885 7:132718270-132718292 TGATCCTCTAGGTTTGCTGGAGG - Intronic
1033082334 7:138310101-138310123 TATCCCTGTGGGCTTCCTTGAGG - Intergenic
1037442354 8:18929306-18929328 TGGCCCTCTGGGCTTGTTTGGGG - Intronic
1037625066 8:20599510-20599532 TGGTCCACTGGGATTCCGTGAGG - Intergenic
1038679761 8:29655743-29655765 TGCTTCTCTGGTCTTCCTTCTGG + Intergenic
1040518194 8:48151532-48151554 TGACCTTCTGGCCATCCTTGAGG - Intergenic
1046098937 8:109592530-109592552 TGACCCTCTTGGCCTCCTTAAGG - Intronic
1048952367 8:139506932-139506954 TGGGACTCTGGGCTTCCTTTTGG - Intergenic
1050061241 9:1711911-1711933 TGATTCTCTGGCCTTCCCAGTGG - Intergenic
1050815011 9:9799517-9799539 TGATACACTGTGTTTCCTTGGGG + Intronic
1051944191 9:22546671-22546693 TGAGTCTCTGGTCTACCTTGAGG + Intergenic
1052499219 9:29267883-29267905 TGATCCTCTGCCCTTCCTTGGGG + Intergenic
1056132623 9:83601024-83601046 GGCTCCTCTAGGCTTCCTCGTGG + Intergenic
1056232516 9:84561199-84561221 TGATTCTCAGGGTTTCCTTAGGG - Intergenic
1056735655 9:89207533-89207555 TGAACCTCTTGGTTTCCTGGAGG - Intergenic
1057179455 9:93021976-93021998 TCATCCTCCAGGGTTCCTTGTGG - Intronic
1061812109 9:133168131-133168153 TGTTCTTCTGGGCATCCCTGGGG - Intergenic
1062450795 9:136614913-136614935 CCCTCCTCTGGGCTTCCTGGTGG - Intergenic
1062691989 9:137846605-137846627 TGATCCAGGGGGCTTCCTAGGGG - Intronic
1186460377 X:9743759-9743781 TGCCCCTCTGGCCTTGCTTGTGG - Intronic
1186652885 X:11579880-11579902 TTCTCCTCTGCCCTTCCTTGGGG - Intronic
1189845121 X:45128851-45128873 TGATTGTCTGGGCTTCCAAGAGG + Intergenic
1190880929 X:54492202-54492224 TGATCCTGTCTGCTTCCTGGTGG - Intronic
1191879226 X:65828122-65828144 GGGTTCCCTGGGCTTCCTTGGGG - Intergenic
1192183448 X:68930437-68930459 TGATACTATGGGATTCCTTGAGG + Intergenic
1192446465 X:71215058-71215080 TGATCCTCTGAGCTCCCTATGGG - Intergenic
1194553714 X:95332444-95332466 TGGTTCCCTGGACTTCCTTGGGG - Intergenic
1195317212 X:103690966-103690988 TTATTCTCTGGGCTTCACTGAGG - Intergenic
1196135618 X:112206597-112206619 GGTTCCTCAGGGCTTCATTGTGG + Intergenic
1198110172 X:133496043-133496065 TGATCGTCTTTGTTTCCTTGAGG + Intergenic
1199157390 X:144566760-144566782 TGATCCTCTAGTCATCCCTGTGG - Intergenic
1199850997 X:151724864-151724886 TCTTCCTCTGAGCTTCCCTGTGG - Intergenic
1200104097 X:153702887-153702909 GGCTCCTCTGGACTTCCCTGCGG + Intronic
1202605550 Y:26636887-26636909 TGTTGCTCTGAGCTGCCTTGAGG + Intergenic