ID: 905413493

View in Genome Browser
Species Human (GRCh38)
Location 1:37788663-37788685
Sequence TCCAGGTGCAGAAAAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905413493_905413499 -4 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413499 1:37788682-37788704 TGGATGTTGTCCTGTGGGAATGG No data
905413493_905413497 -9 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG No data
905413493_905413500 5 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413500 1:37788691-37788713 TCCTGTGGGAATGGAATGCTTGG No data
905413493_905413496 -10 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413496 1:37788676-37788698 TGCACCTGGATGTTGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905413493 Original CRISPR TCCAGGTGCAGAAAAGGGAA TGG (reversed) Intergenic