ID: 905413497

View in Genome Browser
Species Human (GRCh38)
Location 1:37788677-37788699
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905413493_905413497 -9 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type