ID: 905413499

View in Genome Browser
Species Human (GRCh38)
Location 1:37788682-37788704
Sequence TGGATGTTGTCCTGTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905413495_905413499 -10 Left 905413495 1:37788669-37788691 CCTTTTCTGCACCTGGATGTTGT No data
Right 905413499 1:37788682-37788704 TGGATGTTGTCCTGTGGGAATGG No data
905413493_905413499 -4 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413499 1:37788682-37788704 TGGATGTTGTCCTGTGGGAATGG No data
905413494_905413499 -9 Left 905413494 1:37788668-37788690 CCCTTTTCTGCACCTGGATGTTG No data
Right 905413499 1:37788682-37788704 TGGATGTTGTCCTGTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905413499 Original CRISPR TGGATGTTGTCCTGTGGGAA TGG Intergenic