ID: 905413500

View in Genome Browser
Species Human (GRCh38)
Location 1:37788691-37788713
Sequence TCCTGTGGGAATGGAATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905413495_905413500 -1 Left 905413495 1:37788669-37788691 CCTTTTCTGCACCTGGATGTTGT No data
Right 905413500 1:37788691-37788713 TCCTGTGGGAATGGAATGCTTGG No data
905413494_905413500 0 Left 905413494 1:37788668-37788690 CCCTTTTCTGCACCTGGATGTTG No data
Right 905413500 1:37788691-37788713 TCCTGTGGGAATGGAATGCTTGG No data
905413493_905413500 5 Left 905413493 1:37788663-37788685 CCATTCCCTTTTCTGCACCTGGA No data
Right 905413500 1:37788691-37788713 TCCTGTGGGAATGGAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905413500 Original CRISPR TCCTGTGGGAATGGAATGCT TGG Intergenic