ID: 905414505

View in Genome Browser
Species Human (GRCh38)
Location 1:37794794-37794816
Sequence TGACAGGACCAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905414505_905414515 11 Left 905414505 1:37794794-37794816 CCCAGCTCCCTCTGGTCCTGTCA 0: 1
1: 0
2: 2
3: 30
4: 302
Right 905414515 1:37794828-37794850 GTCCCACTTATCCGCCAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905414505 Original CRISPR TGACAGGACCAGAGGGAGCT GGG (reversed) Intronic
901641919 1:10696957-10696979 GGACAGGACTCGAGAGAGCTTGG + Intronic
902440403 1:16425657-16425679 GGCCAGGATCAGAGTGAGCTGGG - Intronic
902783811 1:18720533-18720555 AGACAGACCCAGAGAGAGCTGGG + Intronic
903598066 1:24511921-24511943 TGACTAGAGCAGAGGGAGCACGG + Intronic
904635977 1:31881879-31881901 GCACAGGACGAGAGGCAGCTTGG + Intergenic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905604890 1:39288911-39288933 TTACGGGATCAGAGGGAGGTGGG - Intronic
905823915 1:41015253-41015275 TTACTGGACCAGAGGGGTCTTGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906700277 1:47852624-47852646 GGATAGGCTCAGAGGGAGCTCGG - Intronic
906745821 1:48221515-48221537 GGACAGGGCCAGTGAGAGCTGGG + Intergenic
907815877 1:57917863-57917885 TTACAGGACAAGAGGTAGATGGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
915049265 1:153050092-153050114 TGCCAGGAGCAGAGGCAGCATGG - Intergenic
915935338 1:160087352-160087374 GGACTGGACCAAAGGGAGGTGGG + Intronic
918513661 1:185338953-185338975 TGAGAGGACACGTGGGAGCTGGG + Intergenic
920347795 1:205317708-205317730 AGGCAGGTGCAGAGGGAGCTGGG + Intronic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
922233459 1:223705646-223705668 TGTCAGCACCACAGGGTGCTGGG - Intronic
922622951 1:227004926-227004948 GGACAGGAGGGGAGGGAGCTGGG + Intronic
922749192 1:228062807-228062829 GCACAGGACCAGGGGGACCTAGG - Intergenic
924110203 1:240691462-240691484 TAACAGGAACAGAGGGTGCGAGG - Intergenic
1062991201 10:1820894-1820916 AGAAAAGAGCAGAGGGAGCTTGG + Intergenic
1064293725 10:14058653-14058675 TTACATGACCAGAGGGAGGTTGG + Intronic
1064956900 10:20921432-20921454 TGACAGGATAAGAGGGAGGTAGG + Intronic
1066228374 10:33407222-33407244 TGAGAGAACAGGAGGGAGCTGGG + Intergenic
1067053603 10:43038941-43038963 TCACAGGAATTGAGGGAGCTGGG + Intergenic
1069697560 10:70398191-70398213 AGACAGGACCAGAGGGAACAGGG + Intergenic
1069702288 10:70435554-70435576 TCGCAGGAGCAGAGGCAGCTGGG - Exonic
1069777928 10:70937662-70937684 GGACAGAACCAGAGGGAGGGCGG + Intergenic
1071437671 10:85662345-85662367 CAAAAGGACCAGAGGGTGCTTGG + Intronic
1071516337 10:86300445-86300467 TGACAGAGCCAGAGGGAACAGGG + Intronic
1074726246 10:116312774-116312796 TGAAAATACCAGATGGAGCTTGG - Intergenic
1076076069 10:127534773-127534795 TGAGAGGACCAGAGCAAGATGGG + Intergenic
1076130142 10:128008372-128008394 TTTCAGGTCCAGAGAGAGCTTGG - Intronic
1076569253 10:131421539-131421561 TGACAGGACCCGTGGGTGCCTGG + Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1076884822 10:133257527-133257549 TGAGAGGCCCGGAGGGAGCAGGG - Intergenic
1078176083 11:8972070-8972092 TGACAGGAACAGAAGGAACTTGG + Intergenic
1080593348 11:33743731-33743753 TGAAAGGAGCAGAGGGAATTAGG - Intronic
1081696299 11:45111389-45111411 CGACAGGACAACAGGGACCTTGG + Intronic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1083750131 11:64756228-64756250 TGGCAGCACCAGAGGGAGCCAGG + Intronic
1084435559 11:69137274-69137296 TGACATGTCCAGGGAGAGCTGGG + Intergenic
1084566425 11:69931382-69931404 TGCCAGGACCAGAGGAAGCAGGG - Intergenic
1084943310 11:72625801-72625823 GGGCAGGAGGAGAGGGAGCTTGG - Intronic
1085514079 11:77102369-77102391 AGGCAGGACCAGAGAGGGCTTGG - Intronic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1088345297 11:108817294-108817316 TGACTGGACTAGAGTGAGCAGGG - Intronic
1088880811 11:113971987-113972009 TAACAGGATTAGAGGGAGCCGGG - Intergenic
1089108624 11:116036316-116036338 TGACAGGACAGGAGGCAGCCTGG + Intergenic
1089314475 11:117582233-117582255 TTACAAGTCCAGAGGGACCTGGG + Intronic
1089366793 11:117925622-117925644 TGACAGCACCAGATGGGGGTTGG - Intronic
1089493600 11:118898008-118898030 AGACAGGAGCAGAAGGGGCTGGG + Exonic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090187448 11:124747535-124747557 TCACACGACCATAGGGAGCTTGG + Exonic
1090214871 11:124953193-124953215 TGACTGGAGCAGAGGGAGAGTGG - Intergenic
1090829240 11:130409465-130409487 TGGAAGGACCATCGGGAGCTTGG - Intronic
1090959114 11:131540012-131540034 TGACAGGACCGTAGTGAGCAAGG - Intronic
1091414632 12:270788-270810 TGAGTGGAGCAGAAGGAGCTGGG - Intergenic
1091777524 12:3194229-3194251 TGACTGGAGCAGAGGCAGGTGGG + Intronic
1094834415 12:34315612-34315634 TGCCAGGACCAGTGGCTGCTGGG + Intergenic
1096797341 12:54086111-54086133 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1099046586 12:77728171-77728193 TAACAGGACTGGAGTGAGCTGGG - Intergenic
1099458878 12:82898682-82898704 TGACAGGAAGAGAGGGAGAAAGG + Intronic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1100357903 12:93849220-93849242 AGACAGTGCCAGAGGGAGCTGGG + Intronic
1100866875 12:98866609-98866631 TGAAGGGTCCAGAGGGAACTTGG - Intronic
1101244791 12:102875124-102875146 TGAAAGGAACAGAGAGAGCCTGG + Intronic
1101831728 12:108263133-108263155 GGACGGGAGCAGAGGGAGGTAGG + Intergenic
1101991503 12:109489391-109489413 TGAGAGCTGCAGAGGGAGCTAGG + Intronic
1102222897 12:111206479-111206501 TGACAGGAACACAGAGAGCAAGG - Intronic
1102453670 12:113058128-113058150 TGCCAGGCCCAGGAGGAGCTGGG + Exonic
1102500510 12:113349013-113349035 GGTCAGGAACAGAGGGAGCAAGG - Intronic
1102627027 12:114243387-114243409 TGACTTGAACAGTGGGAGCTGGG + Intergenic
1102689660 12:114750456-114750478 GGAGAGGATCAAAGGGAGCTGGG + Intergenic
1103933104 12:124460885-124460907 TGCCAGGACCAGGGGCAGCCAGG - Intronic
1104737986 12:131151644-131151666 TAAAAAGACCTGAGGGAGCTGGG + Intergenic
1106626429 13:31425334-31425356 TGACAGGAGAACAGGGAGCAGGG + Intergenic
1108146551 13:47483507-47483529 TGACAGGAGCATGGGGAGGTTGG + Intergenic
1108509915 13:51147318-51147340 TCACAGGCACGGAGGGAGCTAGG - Intergenic
1109309584 13:60676890-60676912 TGACAGGAAAAGAGAGAGCTGGG + Intergenic
1114544443 14:23488247-23488269 TGATAGGACCATAGAGAGCAAGG - Intronic
1114863610 14:26558397-26558419 TGTTAGGAGCAGAGGGAGTTGGG + Intronic
1117308765 14:54501623-54501645 TGACTGGAGCAGAATGAGCTGGG + Intergenic
1117544971 14:56785873-56785895 TGTCAGGACCAGAGGATGTTTGG - Intergenic
1120247690 14:82026034-82026056 TGGCAGGAGCTGAGGGAGCTAGG + Intergenic
1121124757 14:91399030-91399052 TGGGAGGACCAGAGGGAGAGTGG - Intronic
1121270082 14:92632095-92632117 CGACAGGACCAGACTGAGGTTGG - Intronic
1121435044 14:93913632-93913654 GGACAGGACCAGGGCCAGCTAGG + Intergenic
1122859620 14:104576708-104576730 TCACTGCCCCAGAGGGAGCTGGG + Intronic
1122871535 14:104641080-104641102 GGTCAGGAGCAGAGGGTGCTGGG + Intergenic
1122982030 14:105196339-105196361 TGACAGGCTCAGAGAGAGCGAGG - Intergenic
1123430285 15:20209202-20209224 TGATAGGACCAGAAGGTACTGGG + Intergenic
1124322439 15:28725315-28725337 TGACTGGGCCACAGGGTGCTCGG - Intronic
1126592093 15:50350839-50350861 TGACTTGACCAGAAGGAACTAGG - Intronic
1128998311 15:72313024-72313046 TGACAGTATCAGAGGAAGCCAGG + Intronic
1130147214 15:81283130-81283152 TGCCAGGACCAGACCGAGGTGGG + Intronic
1130255891 15:82325912-82325934 AGGGAGGAGCAGAGGGAGCTGGG + Intergenic
1130313195 15:82772211-82772233 TGACTGGAGCAGAAGGAGCTAGG + Exonic
1130533706 15:84767711-84767733 AGACAGAACTGGAGGGAGCTGGG - Intronic
1132465882 16:77337-77359 GGACGGGCCCTGAGGGAGCTGGG - Intronic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1135067354 16:19321750-19321772 TGACTGGACCATAGGGTGCCTGG + Intronic
1136040359 16:27574000-27574022 TGAAAGGACCTGAGGGAGCAGGG + Intronic
1136854350 16:33642004-33642026 TGATAGGACCAGAAGGTACTGGG - Intergenic
1137576678 16:49604657-49604679 GGACAGGGGCAGAGGGAGCAGGG - Intronic
1138174242 16:54882327-54882349 TGAAAGAACCAGAGTGAGATGGG + Intergenic
1138737380 16:59266065-59266087 TGACAGGGTCAGATGGAGCTAGG - Intergenic
1139400452 16:66677282-66677304 TGGCAGGACCAGAGGAAGACAGG + Intronic
1139651044 16:68362156-68362178 TGACAGGAGCTGAGGGAGCCAGG + Intronic
1141097446 16:81172853-81172875 TGGCAGGAGGAGAGAGAGCTGGG + Intergenic
1141138589 16:81482653-81482675 TGACAGGAAGAGGGAGAGCTAGG + Intronic
1141646742 16:85371613-85371635 TGCCAGCAGCAGAGGCAGCTGGG - Intergenic
1142251593 16:88994332-88994354 GGACAGGAGCTGAGGGAGGTGGG - Intergenic
1203115927 16_KI270728v1_random:1490454-1490476 TGATAGGACCAGAAGGTACTGGG - Intergenic
1142494248 17:297966-297988 GGACAGGACTAGAGAGAGGTGGG - Intronic
1143684681 17:8504347-8504369 AGATAGGACCAGAGGGAGAAGGG - Intronic
1145294186 17:21575028-21575050 TGCCAGGAACAGAGGGAGGCAGG - Intergenic
1145369648 17:22298158-22298180 TGCCAGGAACAGAGGGAGGCAGG + Intergenic
1145802089 17:27694139-27694161 TGAAATGACCAGAGGGTGATGGG + Intergenic
1147145429 17:38481987-38482009 AGACAGAGCCAGAGTGAGCTGGG - Intronic
1147430382 17:40367091-40367113 TGCCAGGGGCAGAGGGAGGTCGG - Intergenic
1147597406 17:41725780-41725802 TGGCAGAACCAGAGGCAGGTGGG + Intronic
1147918380 17:43901704-43901726 TGACAGGGGAAGAGGGAGCAAGG + Intronic
1150314215 17:64155191-64155213 TGACAGGACCACAGAGGCCTTGG + Intronic
1150328753 17:64277673-64277695 GGAGAGGACCGGAGGGACCTAGG - Intergenic
1150548383 17:66186582-66186604 TAAGAGGACAAGAGGCAGCTGGG - Intronic
1152410122 17:80118890-80118912 TGCCAGGAACAGAGGATGCTGGG + Intergenic
1156209023 18:34919016-34919038 TGAAAGGCCAAAAGGGAGCTGGG - Intergenic
1156244588 18:35285026-35285048 TCACAGAGCCAGAGGGAGCGGGG - Intronic
1156245761 18:35296330-35296352 TATCAGGAACAGAGGGAGCCTGG + Intergenic
1156826601 18:41436976-41436998 TGACAGGACCGGAAGTTGCTTGG - Intergenic
1156829380 18:41472318-41472340 TGACAGGACTTGAAGGAGTTTGG + Intergenic
1160710624 19:549461-549483 TCACAGGGCCAGCGGGAGATGGG + Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243336 19:3235072-3235094 TGGCTGGAACAGAGGGAGCGAGG - Intronic
1161851301 19:6739429-6739451 TGAGAGGACGAGAGGGACCCCGG + Intronic
1162954007 19:14088583-14088605 GGACAGGAACAGAGAGAGCCGGG + Intronic
1163689503 19:18730878-18730900 TCCCATGTCCAGAGGGAGCTTGG + Intronic
1164573713 19:29392779-29392801 TAAGATGAGCAGAGGGAGCTGGG + Intergenic
1165158302 19:33801469-33801491 TGACACAGCCTGAGGGAGCTAGG + Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1166691225 19:44822263-44822285 TGCCAGGTCCCGAGGGTGCTGGG + Intergenic
1166792942 19:45408630-45408652 TGAAAGAACCAGAGGCAGCAGGG + Exonic
1166929657 19:46294442-46294464 TGCCAGGAACTGTGGGAGCTTGG - Intergenic
1167237261 19:48322406-48322428 TGAGAGGACTAGGGGGAGCCAGG - Intronic
1167308087 19:48720255-48720277 AGAAAGGTCCAGAGGGGGCTGGG + Intergenic
1167491040 19:49792750-49792772 TGGCAGGACCCCAGGCAGCTGGG - Intronic
1167627756 19:50603940-50603962 TGACAGGAAGAGAAGGAGCGGGG - Intergenic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167958507 19:53087212-53087234 TGACTGGAGCAGAGGGGGCTGGG + Intronic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168130593 19:54316163-54316185 TGACAGGACAGGAGGCTGCTCGG - Intergenic
1168316733 19:55487892-55487914 TCACTGTCCCAGAGGGAGCTGGG - Intergenic
925321702 2:2975299-2975321 TGACAGAACCAGAAAGGGCTGGG - Intergenic
926290173 2:11522704-11522726 TGACACAAGCAGAGGGACCTGGG + Intergenic
927089586 2:19700430-19700452 TGACAGGGACAGAGTGAGCAGGG + Intergenic
927707163 2:25303515-25303537 TGACAGGTCCAGAGAGGGCGGGG + Intronic
927909155 2:26884289-26884311 TTCCAGGACCTGCGGGAGCTGGG + Intronic
928228464 2:29475667-29475689 GGCCAGGACCAAAGGGAGATTGG - Intronic
928445775 2:31332280-31332302 TGACAGGAGCACAGGCAGATAGG + Intergenic
929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG + Intergenic
931179018 2:59881323-59881345 AGATAGGACCAGAGGAAGATGGG - Intergenic
932165270 2:69499403-69499425 TGAAAGTCCCAGAGGGAACTAGG - Intronic
933635245 2:84701715-84701737 TGACAGCACCAAAGGGAGGATGG + Intronic
934157311 2:89215287-89215309 TGACAGGGACAGTGGGAGATTGG + Intergenic
934210004 2:89967456-89967478 TGACAGGGACAGTGGGAGATTGG - Intergenic
940237518 2:151527058-151527080 TGACAGCACAGGAGGAAGCTGGG + Intronic
942017447 2:171831192-171831214 TGAAAGGACCTAAGGGAGCCTGG + Intronic
942034193 2:171994933-171994955 TGGCAGGAGCTGAGGGAGCGAGG - Intronic
946246287 2:218389615-218389637 TGTCAGGACCTGAGGTAGCCAGG + Intronic
948055814 2:235008583-235008605 TGCCAGAACCAAGGGGAGCTTGG - Intronic
948095912 2:235334084-235334106 AGAAAGGACCAGAGGGAGGGAGG - Intergenic
1168853027 20:989581-989603 TGGCAGGAACACAGGGAGTTGGG + Intronic
1170501710 20:16981487-16981509 TGACAGGAGGCAAGGGAGCTAGG - Intergenic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1171849185 20:30295969-30295991 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1172005890 20:31819069-31819091 GGACAGGATCAGAGGGGGCCTGG - Intergenic
1172353573 20:34262747-34262769 TGAGAGGGGCAGAGGGGGCTTGG - Intronic
1172588739 20:36102956-36102978 AGGGAGGAACAGAGGGAGCTAGG - Intronic
1174177323 20:48653214-48653236 TGACCCAACAAGAGGGAGCTGGG - Intronic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174634694 20:51988833-51988855 TGACGGGAGTAGAGGAAGCTGGG + Intergenic
1174962819 20:55177181-55177203 TGACAGGACCCTAAGGTGCTGGG + Intergenic
1175274836 20:57761209-57761231 CCAAAGGACCAGAGGGAGCTTGG - Intergenic
1175770713 20:61622454-61622476 TGTCAGGACATGATGGAGCTTGG + Intronic
1175771032 20:61624484-61624506 TGTCTGGATCAGGGGGAGCTGGG - Intronic
1179592149 21:42415911-42415933 TGGCAGGACCAGGGAGGGCTAGG + Intronic
1180013171 21:45064788-45064810 AGCCAGGACAAGAGGGAGCCTGG + Intergenic
1180069641 21:45429957-45429979 GGAGAGGACGAGAGGGCGCTAGG - Intronic
1182567469 22:31211063-31211085 TGCTGGGACCAGAGGCAGCTGGG + Intergenic
1182953239 22:34397017-34397039 TCACAGGAGCAGAGGTAGCCTGG - Intergenic
1183078685 22:35442625-35442647 TGACAGGTCCAGAGGGTGGGAGG - Intergenic
1183154397 22:36063908-36063930 TGACTGGAGGAGAGGGAGCAAGG - Intergenic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184538134 22:45101344-45101366 TGACAGAAAAAGAGAGAGCTGGG + Intergenic
1184775485 22:46620871-46620893 TGACAGGACGAGAGGAAGGGAGG + Intronic
1184891458 22:47381981-47382003 GGCCAGGACCAGAGGTGGCTCGG + Intergenic
949503173 3:4701473-4701495 GGACAGGAGCAGAGGCAGCCCGG - Intronic
949517278 3:4819173-4819195 TGACAGGCCTAGAGGCAGCCAGG + Intronic
949782887 3:7709945-7709967 TCACAGGAAAAAAGGGAGCTTGG - Intronic
949943531 3:9172773-9172795 TGACAGTAACAGAGAGAGCTGGG + Intronic
950533245 3:13565277-13565299 AGACAGGACCAGCGGCAGGTGGG - Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
955326124 3:58010258-58010280 TGACAGGAAGAAAGGGAGATGGG + Intronic
955407337 3:58633732-58633754 GGACAGGAACAGAGGGAGCTAGG - Intergenic
957769512 3:84671969-84671991 TGAAAGGACCTCAGAGAGCTGGG - Intergenic
959356304 3:105333960-105333982 AGATTGGAACAGAGGGAGCTAGG + Intergenic
960165065 3:114391920-114391942 TGACAAGACCAGAGAGAGGGAGG + Intronic
962973953 3:140429921-140429943 TGACAGCTGCAGAGGGAACTGGG - Intronic
964052791 3:152417306-152417328 TAACAGGACTAGAGGAAGCCAGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
969279868 4:6162448-6162470 TGACAGGGGCAGATGGAGCCAGG + Intronic
970698733 4:18709686-18709708 TGACATGACCAGTGGGACCAGGG - Intergenic
972064808 4:34928280-34928302 TGACAGAAACAGTGGTAGCTGGG + Intergenic
973685425 4:53365349-53365371 CGACCGGACAAGAGGAAGCTGGG - Exonic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
978637324 4:110824809-110824831 AGAAAGGATCTGAGGGAGCTGGG + Intergenic
979994349 4:127412534-127412556 AGAGAGGAACAGAGGGAGGTGGG + Intergenic
980985286 4:139689240-139689262 TCAGGGGACAAGAGGGAGCTGGG + Intronic
981114473 4:140973940-140973962 TGACACCATCAGAGGAAGCTGGG - Intronic
981815760 4:148829355-148829377 TGACATGATTAGAGAGAGCTGGG + Intergenic
981841298 4:149115649-149115671 AGACAGTACCTGAGGGAGCTAGG + Intergenic
982132238 4:152240097-152240119 TGACATGACCAGAGGTCGCAAGG - Intergenic
982595843 4:157381946-157381968 TGACAGGATCAGAGTGAGTGAGG - Intergenic
982722066 4:158869384-158869406 TGACAGGACTGGAGGGTCCTTGG + Exonic
983141001 4:164149108-164149130 TCACATGACAAGAGGGAGCAAGG - Intronic
988663826 5:33302978-33303000 TGACAGGAGGAGAGTGAGCATGG + Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
989778444 5:45236390-45236412 TGAAATGACCATAGGGAGCTAGG - Intergenic
991047522 5:62238177-62238199 TGATAGGACCAGAAGGTACTGGG + Intergenic
992146811 5:73858901-73858923 TGACTGGAGCAGAGGGAGTAAGG - Intronic
993550866 5:89272295-89272317 TGATAGCACCAGAGAGATCTAGG + Intergenic
994525738 5:100903114-100903136 TTCGAGGACCAGAGGGAGCTCGG - Exonic
994593790 5:101806452-101806474 TCACAGAACCAGAGGGAGCCAGG + Intergenic
995200624 5:109421901-109421923 TTACAGGAACAGAGGGAGGCTGG + Intergenic
995431483 5:112084113-112084135 TGACAAGACCAGAGGGTTCCTGG + Intergenic
995446362 5:112248652-112248674 TGGGAAGACCAGAGGGAGTTAGG - Intronic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996523140 5:124449384-124449406 TGACAGGACCACGGGCATCTTGG - Intergenic
997222773 5:132182705-132182727 TGACTGAAGCAGAGGGAGCTGGG + Intergenic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
997266454 5:132497717-132497739 TGGCAGGACCTGAGTGGGCTAGG - Intergenic
997275843 5:132588297-132588319 AGAAAGGACAGGAGGGAGCTAGG + Intronic
997793311 5:136782579-136782601 AGACTGGACCAGAGAGAGCTAGG - Intergenic
998804415 5:145904587-145904609 TGCCAGGACCACACGGAGCAGGG - Intergenic
998979987 5:147691359-147691381 TCACAGTAACAGAAGGAGCTGGG - Intronic
999134061 5:149306109-149306131 TGACAGGAGCAGAGGGACTGTGG + Intronic
999436185 5:151565625-151565647 TGCCAGGGCCAGAGGTAGATGGG - Intronic
999619985 5:153463098-153463120 TGACAGGAGAAGAGCAAGCTTGG + Intergenic
1001293946 5:170485704-170485726 TGCCAGGCCCAGAGGCAGCCTGG - Intronic
1002056278 5:176599561-176599583 TGACGGCCCCAGAGGGAGCCTGG - Exonic
1002503664 5:179664344-179664366 TGGCAGGGGCAGTGGGAGCTGGG - Intergenic
1004386455 6:15177358-15177380 TGATAGAACCAGATGGTGCTGGG + Intergenic
1004634558 6:17454255-17454277 TGACTGGAGCAGAGGGTACTTGG + Intronic
1006822451 6:36908274-36908296 TGACAGGAGCAGAGGTGGCCAGG - Intronic
1007481674 6:42154273-42154295 AGACAGGACCCTAGGGAGGTAGG + Intergenic
1007719081 6:43874766-43874788 TGATAGGCCCAGAAGGGGCTTGG + Intergenic
1007983968 6:46188868-46188890 TGACAGGACCAGAAGGGACAGGG - Intergenic
1011961893 6:93101041-93101063 AGACTGGAGCAGAGGGAGATAGG + Intergenic
1015279095 6:131413352-131413374 ATAAAGGACTAGAGGGAGCTGGG + Intergenic
1018437583 6:163776776-163776798 TGACAACACCCGTGGGAGCTGGG - Intergenic
1019228080 6:170531963-170531985 TGACAGGAGCTTAAGGAGCTGGG - Intergenic
1019710709 7:2517031-2517053 GGACAGGACAAAGGGGAGCTGGG - Intronic
1022419435 7:30206573-30206595 TGAAGGGAGCAGAGGGAGCCTGG + Intergenic
1023516937 7:41010555-41010577 TGGCTGGAACAGAGGGAACTTGG + Intergenic
1023839526 7:44088554-44088576 AAACAGCACCAAAGGGAGCTTGG - Intergenic
1023925634 7:44667486-44667508 TGAGAGGAACAGAGGGAGAGAGG - Intronic
1027190528 7:75993579-75993601 TGGCAGGGCCAGGGGCAGCTGGG + Intronic
1028103912 7:86854922-86854944 TGAAAGTTCCAGAGGGAGCCTGG - Intronic
1028973749 7:96889382-96889404 TGGCAGGAACAAAGGGTGCTTGG + Intergenic
1029141926 7:98417486-98417508 TGACCAGGACAGAGGGAGCTGGG - Intergenic
1032255443 7:130293462-130293484 TGGCAGGAGATGAGGGAGCTGGG - Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032471100 7:132179930-132179952 ACACAGGGCAAGAGGGAGCTGGG + Intronic
1032740220 7:134730997-134731019 TGACAGAACCAGAGATATCTAGG - Intergenic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1034526620 7:151667783-151667805 TGGCTGGACCAGAGTGACCTCGG - Intronic
1034552717 7:151831845-151831867 TGGCAGGATCAGAGGCCGCTAGG + Intronic
1034963416 7:155376063-155376085 TGACGGGACCAGAGGGTCTTTGG + Intergenic
1035081729 7:156221921-156221943 TAACAGGAGCAGAGGCAGCATGG - Intergenic
1035175476 7:157046902-157046924 TCACAGAACCACAGGCAGCTGGG + Intergenic
1037570427 8:20153305-20153327 TGACAAGCCCAGAGGGAGTGAGG + Intronic
1037749176 8:21668983-21669005 TTACAGGGCCAGAGGGAACTTGG + Intergenic
1037910783 8:22742424-22742446 TGACAGGACCACAGGCCGATGGG - Intronic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038069235 8:23995083-23995105 TGACAGGAACAGAGAGAGCTTGG + Intergenic
1038342252 8:26696419-26696441 TGTCAGGAGCAGATGGATCTTGG - Intergenic
1038537957 8:28368112-28368134 TGACAGTTCCAGAAGGAGGTGGG + Intronic
1038865767 8:31437230-31437252 TGACAGCAGCAGAGGGGGGTGGG + Intergenic
1044751794 8:95423243-95423265 AGACAGGACCAAAAGGAGCTGGG - Intergenic
1044831514 8:96254440-96254462 TCATAGGAGCAGAGGGAGCTGGG - Intronic
1046283933 8:112071403-112071425 GTAGAGGACCAGAGGGAGGTGGG - Intergenic
1047234243 8:123025384-123025406 TGACAGGCTGGGAGGGAGCTTGG - Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1049046487 8:140156009-140156031 TAACATGACTGGAGGGAGCTCGG - Intronic
1049439533 8:142602823-142602845 TGGAGGGACCAGAGGGGGCTAGG + Intergenic
1049650145 8:143762568-143762590 TGTCATGTCCACAGGGAGCTTGG - Intergenic
1049685187 8:143936542-143936564 TGGCAGGACGACAGGCAGCTAGG - Intronic
1053303874 9:36970349-36970371 TGAAAGGAACAGAGGGAGAGAGG + Intronic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1053786906 9:41658688-41658710 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1055307298 9:74943046-74943068 TGACAGGAGCAGAAGGAAGTGGG + Intergenic
1057680883 9:97183604-97183626 TGACAAGACCTGAGTGAGATGGG + Intergenic
1058336704 9:103838283-103838305 TGAAAGGAGGAGAGGGAGTTAGG - Intergenic
1058894457 9:109387473-109387495 TCACAGGGCCAGAGGCAGATAGG - Intronic
1059801739 9:117756589-117756611 TGATAGGGACAGAGGGTGCTAGG - Intergenic
1059923005 9:119178950-119178972 TGGCAGGTCCAGAGGAAGCAAGG - Intronic
1060423836 9:123488316-123488338 TTACAAGACCAGAGGGAGCATGG + Intronic
1060958958 9:127665386-127665408 TGACAGTCCCAGAGACAGCTTGG + Intronic
1061159967 9:128888066-128888088 TTACAGCAGCAGAGGGAGGTCGG + Intronic
1062333803 9:136056160-136056182 TGCCAGGGCCTCAGGGAGCTGGG + Intronic
1188106827 X:26156451-26156473 TGACTGGAGCAGGGGCAGCTGGG + Intergenic
1189712503 X:43827760-43827782 TGGCTGGACCAGGGTGAGCTGGG + Intronic
1190260144 X:48792290-48792312 GGAGAGGAGAAGAGGGAGCTAGG - Intronic
1190501055 X:51078807-51078829 TGAAAGGACCAGAGGAAGGCCGG - Intergenic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1192247388 X:69384990-69385012 TGACAAGACCATAGGGATGTTGG - Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1194261296 X:91699401-91699423 TGTCAGCACAAGAGGGAGCAGGG + Intergenic
1195561065 X:106284502-106284524 TGCCAGGGCCAAAGGAAGCTGGG + Intergenic
1197654891 X:129106274-129106296 TGACAGGAGCAGAAGGTGCCCGG - Intergenic
1198732790 X:139751270-139751292 TGAGAGGTACACAGGGAGCTGGG + Intronic
1200002778 X:153070847-153070869 GGACAGGACCAAAGGCTGCTCGG + Intergenic
1200004945 X:153079162-153079184 GGACAGGACCAAAGGCTGCTCGG - Intergenic
1200085243 X:153601038-153601060 TGTCAGCAGCACAGGGAGCTGGG - Intergenic
1200579947 Y:4938202-4938224 TGTCAGCACAAGAGGGAGCAGGG + Intergenic
1202265218 Y:23011042-23011064 TGTCCTGACCACAGGGAGCTTGG + Intergenic
1202418209 Y:24644784-24644806 TGTCCTGACCACAGGGAGCTTGG + Intergenic
1202452577 Y:25025302-25025324 TGTCCTGACCACAGGGAGCTTGG - Intergenic