ID: 905414697

View in Genome Browser
Species Human (GRCh38)
Location 1:37795745-37795767
Sequence GTCCTGTCCTGGTACCCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905414693_905414697 4 Left 905414693 1:37795718-37795740 CCTCTGTGTTGCGTCTCAGGCGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG 0: 1
1: 0
2: 1
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905414697 Original CRISPR GTCCTGTCCTGGTACCCACC TGG Exonic