ID: 905414697

View in Genome Browser
Species Human (GRCh38)
Location 1:37795745-37795767
Sequence GTCCTGTCCTGGTACCCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905414693_905414697 4 Left 905414693 1:37795718-37795740 CCTCTGTGTTGCGTCTCAGGCGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG 0: 1
1: 0
2: 1
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905414697 Original CRISPR GTCCTGTCCTGGTACCCACC TGG Exonic
900495930 1:2976241-2976263 GTCCGGTCATGGTGCCCAGCAGG + Intergenic
905215178 1:36401649-36401671 CTCCTGTCCTGGGTTCCACCTGG + Intergenic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
906201891 1:43965900-43965922 GTCATGTCCTGGTACCACTCGGG + Intronic
906330726 1:44881909-44881931 ATCCTGTCTCAGTACCCACCAGG - Intronic
907222936 1:52920862-52920884 GTCCTCTGCTGGTAACCATCAGG - Intronic
908514528 1:64878993-64879015 GTACTGACCTGGTACCTGCCTGG - Intronic
908727424 1:67191833-67191855 GTCCTGTCCTGGAAGCCAAATGG - Intronic
913958460 1:143322574-143322596 GTCCTGTCCCAGTACTGACCCGG - Intergenic
914052777 1:144147954-144147976 GTCCTGTCCCAGTACTGACCCGG - Intergenic
914126420 1:144818587-144818609 GTCCTGTCCCAGTACTGACCCGG + Intergenic
919814716 1:201430094-201430116 GTCCTGTCCTGCTCCCCTCGAGG + Intergenic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
922908915 1:229199285-229199307 GTGCTGTCCAGGTGCCGACCTGG + Intergenic
1063353004 10:5373762-5373784 GGCCTGTCCTGGGGCCCCCCAGG - Exonic
1064478042 10:15712645-15712667 GTACTGTCATGGTATCCATCAGG + Intronic
1066194061 10:33081562-33081584 CCCCTGTCCTGGTCCACACCTGG - Intergenic
1067144189 10:43681865-43681887 GTCCAGTCCTTGAACCCACTGGG - Intergenic
1068049612 10:51932653-51932675 GTCCTGTCACAGTCCCCACCAGG - Intronic
1071300495 10:84252846-84252868 GTCCTGTGCAGGTAGCCAGCTGG + Exonic
1071503421 10:86219159-86219181 CTTCTGTCTTGGTCCCCACCAGG - Intronic
1076813117 10:132899337-132899359 CTCTTGCCCTTGTACCCACCTGG - Intronic
1077385058 11:2265399-2265421 GTCCAGGCCTAGTCCCCACCTGG - Intergenic
1077670640 11:4154231-4154253 GTTCTTCCCTGGTCCCCACCTGG + Intergenic
1084264830 11:67999491-67999513 CTCCTGCCCTGCTGCCCACCAGG + Intronic
1084666847 11:70580943-70580965 GCCCTGACCTGGAGCCCACCAGG + Intronic
1086245584 11:84748133-84748155 TTCCTGTCCTGGTATCCAAATGG - Intronic
1088357516 11:108959465-108959487 CTCCTGTGCTGGGACCCACAAGG - Intergenic
1089616750 11:119699182-119699204 GGCCTGTGCTGGTACCTACCAGG - Intronic
1091291013 11:134439920-134439942 GTCCTTTCCTGATCACCACCTGG - Intergenic
1096925040 12:55135145-55135167 CTGCTGTCCTGGGAACCACCTGG + Intergenic
1101501814 12:105311191-105311213 CCCCTGTCTGGGTACCCACCAGG + Intronic
1104566393 12:129888738-129888760 TTGCTGTCCTGTTAACCACCCGG + Intronic
1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG + Intronic
1107129956 13:36884626-36884648 CTCCTGTACTGTTACCCAGCCGG - Intronic
1113904444 13:113812779-113812801 GACCTGTCCTGTGACCCACCCGG - Exonic
1118788769 14:69069384-69069406 GTCCTTCCTTGCTACCCACCTGG - Intronic
1121360203 14:93250188-93250210 GTCCTGTTCTGGTATCATCCTGG - Intronic
1121456783 14:94043432-94043454 GACCTGTCCTGGTGCCCTCAGGG - Intronic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1124254626 15:28130810-28130832 GCCCTGTGCTGGGTCCCACCGGG - Intronic
1125410847 15:39404745-39404767 GTCCTGGGCTGGTTCCCAGCTGG - Intergenic
1125577227 15:40764149-40764171 GTCCCGGCCTGGCTCCCACCGGG - Exonic
1126143306 15:45454910-45454932 CTCCTGTGCTGTTACCCAGCAGG + Intergenic
1126197589 15:45949386-45949408 GTCCTATCCTGGCAATCACCTGG + Intergenic
1126908189 15:53389791-53389813 GTACCGTCCTGGTACCCAGATGG + Intergenic
1129683519 15:77671663-77671685 GTCCCCGCCTGGTACCCACCTGG + Intronic
1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1130460085 15:84154071-84154093 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic
1130697572 15:86145982-86146004 GTCCTTTCCTGGAGTCCACCTGG - Intronic
1131399149 15:92110739-92110761 CTCATGTCCTGGTACACAGCAGG + Intronic
1132854119 16:2037213-2037235 GTCCTCTCCTGGGCACCACCTGG + Intronic
1133397352 16:5458827-5458849 GGCCATTCCTGGTACCCATCAGG - Intergenic
1138654228 16:58481627-58481649 CTCCTGTCCTGCCACCCACCCGG + Intronic
1139577953 16:67854350-67854372 TTCCTGTGGTGGTACCCATCAGG + Intronic
1142201689 16:88764080-88764102 GTCCTGCTCTGGTGCCCCCCGGG - Intronic
1143762090 17:9112178-9112200 GTCCTGTCCTTGGCCCCACTGGG - Intronic
1147406989 17:40219418-40219440 GTCCTGTCCTGCTCGCCCCCCGG - Exonic
1147419737 17:40316633-40316655 GTCCTGGGCTGGTTCTCACCTGG + Intronic
1147553570 17:41462297-41462319 TTCCTGTCCTGCTCCCCACCAGG + Intronic
1152141368 17:78538824-78538846 GTCGTGCCCTTGTACCGACCAGG - Intronic
1152230736 17:79112869-79112891 GCCCTGACCTGGTGCCAACCTGG + Intronic
1153233477 18:2963397-2963419 GACCTGTCCTGGTCAACACCTGG + Intronic
1157438361 18:47690273-47690295 GTCATGTCCTGGTACTAGCCTGG + Intergenic
1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG + Intergenic
1161397715 19:4053238-4053260 GGCCTGTGCTGTCACCCACCGGG + Intronic
1164762105 19:30736021-30736043 GTCCTGTCCTTGAACCCCCAGGG + Intergenic
1165069730 19:33248397-33248419 GTCCTGTGCTGGCACCAACTGGG + Intergenic
1165725593 19:38110442-38110464 GCCCTGTACTGGGACCCACTTGG - Intronic
1167233045 19:48297381-48297403 GTACCGTCCTGGTGCCCACCAGG - Exonic
1202692173 1_KI270712v1_random:100378-100400 GTCCTGTCCCAGTACTGACCCGG - Intergenic
925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG + Intergenic
925976640 2:9146510-9146532 TTCCTGTCCTGGTTGACACCTGG + Intergenic
927450678 2:23206816-23206838 CTCCTGTCCGTGGACCCACCCGG + Intergenic
927801044 2:26099968-26099990 GTCCTGTCCTGGGTCCTACCCGG + Intronic
928080969 2:28311679-28311701 GTACTGGGCTAGTACCCACCTGG + Intronic
928103616 2:28453552-28453574 TCCCTGTGCTGGGACCCACCTGG - Intergenic
928181679 2:29072568-29072590 GACCAGTCCTGGTGCCCACAGGG + Exonic
934238420 2:90249814-90249836 GTCCTGTCCCAGTACTGACCCGG + Intergenic
935142418 2:100365087-100365109 CCCCTGTCTGGGTACCCACCAGG - Intergenic
938912547 2:135898738-135898760 GTCCCTTCCTGGTATACACCTGG - Intergenic
946156917 2:217813145-217813167 GTCCTGTCCTGGGTTCCTCCAGG - Intronic
946309942 2:218877893-218877915 GCCCAGTCCTGGTGCCCAGCTGG - Intergenic
947588845 2:231373121-231373143 GTCCTGACCTGTCAGCCACCAGG + Intronic
1171482054 20:25461372-25461394 GTCCTGGCCCGGTAAGCACCTGG + Intronic
1173247980 20:41349181-41349203 GTCCTGGCCTGCAGCCCACCTGG - Intronic
1174055524 20:47795577-47795599 GGCAGGTCCTGGTACCCACAAGG + Intergenic
1175537137 20:59722564-59722586 GTCCTGTGCTGAAACCCTCCAGG - Intronic
1175897868 20:62347331-62347353 GCCCTGTCCTAGGCCCCACCCGG - Intronic
1177715092 21:24829801-24829823 TTTCTGTCCTGGAACCCAACAGG + Intergenic
1179023060 21:37657052-37657074 GTCCTGCCCTGGTACCCACATGG + Intronic
1180844658 22:18974593-18974615 GTCCTCAGCTGGCACCCACCAGG + Intergenic
1180852411 22:19028240-19028262 GCTCTGTCCTGGGGCCCACCCGG + Intergenic
1180876769 22:19178446-19178468 GCGCGGTCCTGGTCCCCACCCGG - Intronic
1180985413 22:19901256-19901278 CTCCTGTCCTGGCACCCACGGGG + Intronic
1181051686 22:20241036-20241058 TTCCTCTCCTGCCACCCACCAGG + Intergenic
1181056814 22:20264118-20264140 GTCCTCAGCTGGCACCCACCAGG - Intronic
1181589884 22:23877541-23877563 GTCCTCTCTTGGTCCCAACCTGG + Intronic
1182629855 22:31676818-31676840 GTCCTTTGCTGGTACCTGCCGGG - Intronic
1183058860 22:35323174-35323196 GCCCTGTCCTGGCACTCACCTGG - Exonic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183588774 22:38768106-38768128 GTCCTGTCCAGGGAGACACCTGG - Intronic
1184164475 22:42719775-42719797 GACCTGGCCTGAGACCCACCAGG + Intronic
1184403218 22:44285946-44285968 GCCCGGGCCTGGTCCCCACCTGG + Intronic
1184601822 22:45548498-45548520 GTCCTGTGCTGCTGCCCTCCCGG + Intronic
1184796278 22:46735238-46735260 GTCCTGCCCTACTTCCCACCAGG + Intronic
1185314090 22:50171301-50171323 GGCCTTTCCTGGTCCCCACCTGG - Intronic
953172643 3:40521921-40521943 TTCCTGTCATGGTTCCAACCTGG + Intergenic
954221568 3:49158182-49158204 GTCCTGCTCTGGTACCCTCCTGG + Intergenic
954441626 3:50525320-50525342 ATCCTCTCCCGGTACCCGCCAGG - Intergenic
960457632 3:117892461-117892483 GTCCAGTCCTGGGACTCAACTGG - Intergenic
962502535 3:136009819-136009841 CTCATTTCATGGTACCCACCTGG + Intronic
966859117 3:184218898-184218920 GTTCTTTCCTGGAACTCACCAGG - Intronic
968983964 4:3865430-3865452 TTCCTGTGCAGGTACTCACCGGG + Intergenic
968985337 4:3871735-3871757 TTCCTGTCCCGGTGCACACCCGG - Intergenic
969630071 4:8330728-8330750 CTCCTCTCCTGGTATCCATCGGG - Intergenic
969725676 4:8916738-8916760 ATCCCTTCCTGGTACCCAACTGG - Intergenic
973061468 4:45731294-45731316 GTCATCTCCTGGTATCCACAAGG + Intergenic
975263066 4:72328329-72328351 GTCCTGTCCGGGAACAAACCTGG - Intronic
976208500 4:82644227-82644249 GTCCAGGCCTGGTCCCCACTGGG + Intronic
984695037 4:182770603-182770625 GACCTGGCCAGGTCCCCACCTGG + Intronic
984863604 4:184261440-184261462 GTCCTTTCCTCTTACACACCGGG - Intergenic
987092823 5:14522885-14522907 GTCCTGTCCTTTCATCCACCTGG + Intronic
995559135 5:113362187-113362209 GTCTTGTTCTGTTACCCAGCTGG + Intronic
996081798 5:119265782-119265804 GTCCTTTCCCTGTACCCACCTGG - Intergenic
997525424 5:134549919-134549941 GTCCTGTGCTGGGGCCCACAGGG + Intronic
1003179124 6:3777262-3777284 GACCTGTCCTGGTGGACACCTGG + Intergenic
1006830235 6:36963982-36964004 GCCCTGGCCTCATACCCACCTGG + Intronic
1007104376 6:39273488-39273510 GGCCTGTGCTGGTACCCAGCAGG + Intergenic
1007634008 6:43287310-43287332 GTCATATCCTGGTCCCCACCTGG - Exonic
1007792904 6:44323286-44323308 GTCTTGTTCTGTTACCCATCTGG + Intronic
1013817971 6:114121954-114121976 GTCCTGTCCCAGGCCCCACCTGG + Intronic
1015520221 6:134122484-134122506 GTCTTGTTCTGTTGCCCACCAGG - Intergenic
1018939606 6:168300305-168300327 CTCCTGTCCTGGACCCCTCCTGG - Intronic
1019149768 6:169997440-169997462 GTGCTGTCCTGGCAGCCATCAGG - Intergenic
1021548343 7:21841646-21841668 GTCCAGGGCTGGTTCCCACCTGG + Intronic
1022197224 7:28081072-28081094 TTCCTGTGCTGGTCCCCACGAGG - Intronic
1022375635 7:29808032-29808054 GTCCTGTCCAGGTATTGACCTGG - Intronic
1023966194 7:44964192-44964214 GTGCTGCCCTGTCACCCACCAGG + Intronic
1025237459 7:57244554-57244576 GGCAGGTCCTGGTACCCACAAGG - Intergenic
1027390114 7:77696153-77696175 GTTCTTCCCTGATACCCACCGGG + Intergenic
1035300018 7:157891059-157891081 GTCCTCTCCTGGGTCACACCTGG + Intronic
1036901506 8:12673217-12673239 GTCCTTTCCTGGTAGGCACTGGG - Intergenic
1037597645 8:20367767-20367789 GTCATGTCCTGGTGCCCAGAGGG - Intergenic
1037914856 8:22766829-22766851 GGCCTGTGCTGTGACCCACCTGG - Intronic
1044718254 8:95121233-95121255 TGCCTGTCCTGGTGCCCACCAGG + Intergenic
1048025846 8:130586035-130586057 GACCACTCCTGGTATCCACCAGG + Intergenic
1049221746 8:141431699-141431721 GTCCTGTCCTGATACCGAGGTGG + Exonic
1049485671 8:142858746-142858768 GTGCTGTCTGGGGACCCACCAGG + Intronic
1049710355 8:144060486-144060508 GTCCTGTCCCGGGGCCCGCCAGG - Intronic
1049937328 9:511957-511979 GTCATTCCCTGGTACCCAGCTGG + Intronic
1050361741 9:4836969-4836991 GTTCTCTCCTGGTACACACAAGG - Intronic
1056910374 9:90695285-90695307 GTCCTGTGCTGGTGGCCAGCTGG - Intergenic
1061163818 9:128911145-128911167 GTCCTGTCCTGGGGCCCAGGAGG - Intronic
1061885093 9:133587408-133587430 CCCCTGGCCTGGTCCCCACCAGG + Intergenic
1062382044 9:136291203-136291225 GTCCTGTCCTTGGGCCCCCCAGG + Exonic
1187959593 X:24555841-24555863 GTCATGTCCTGCTACGCACATGG + Intergenic
1190283418 X:48946430-48946452 CTCCTGTCCCGCTACTCACCTGG - Intronic
1190332142 X:49242566-49242588 GCCCTCTCCTGATCCCCACCTGG + Intronic
1191125202 X:56946986-56947008 CCCCTGTCTGGGTACCCACCAGG + Intergenic
1196780223 X:119376996-119377018 GTACTCTCCTGGTATACACCCGG + Intergenic
1197665766 X:129221644-129221666 GTCCTGGCCTGGGAAGCACCAGG + Intergenic
1199423081 X:147669167-147669189 GCCCTTTCCTGGAACACACCAGG - Intergenic
1200094052 X:153649070-153649092 GGTGTGTCCTGGTACCCACGTGG - Intronic
1202379165 Y:24261102-24261124 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1202491617 Y:25409019-25409041 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic