ID: 905414718

View in Genome Browser
Species Human (GRCh38)
Location 1:37795828-37795850
Sequence TCACCTGGATGCTGTACTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905414718_905414720 -8 Left 905414718 1:37795828-37795850 CCATCAGTACAGCATCCAGGTGA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 905414720 1:37795843-37795865 CCAGGTGAGTCTCCAAGAAGAGG 0: 1
1: 0
2: 0
3: 23
4: 190
905414718_905414723 17 Left 905414718 1:37795828-37795850 CCATCAGTACAGCATCCAGGTGA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 905414723 1:37795868-37795890 ACGTGCTCTCTGCCCTATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905414718 Original CRISPR TCACCTGGATGCTGTACTGA TGG (reversed) Exonic