ID: 905414718

View in Genome Browser
Species Human (GRCh38)
Location 1:37795828-37795850
Sequence TCACCTGGATGCTGTACTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905414718_905414723 17 Left 905414718 1:37795828-37795850 CCATCAGTACAGCATCCAGGTGA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 905414723 1:37795868-37795890 ACGTGCTCTCTGCCCTATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
905414718_905414720 -8 Left 905414718 1:37795828-37795850 CCATCAGTACAGCATCCAGGTGA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 905414720 1:37795843-37795865 CCAGGTGAGTCTCCAAGAAGAGG 0: 1
1: 0
2: 0
3: 23
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905414718 Original CRISPR TCACCTGGATGCTGTACTGA TGG (reversed) Exonic
900363889 1:2302753-2302775 GCACGTGGAGGCTGTGCTGAGGG - Intronic
903243289 1:21998454-21998476 GCATCTGGATGGTGTCCTGATGG - Intronic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
905414718 1:37795828-37795850 TCACCTGGATGCTGTACTGATGG - Exonic
906581077 1:46935527-46935549 CCACCTGGATGCTGCCCTGATGG + Exonic
906602647 1:47143367-47143389 CCACCTGGATGCTGCCCTGATGG - Exonic
907829807 1:58053967-58053989 TCACTTGTATGCTATACTGAAGG + Intronic
911076692 1:93882567-93882589 TCACCTGAAGGCTGGACTGAGGG - Intergenic
914429860 1:147611500-147611522 TCACCTTGATCCTGTTGTGAGGG + Intronic
914972026 1:152314737-152314759 TCATCTGGATTCTGTACAGAGGG + Exonic
915054951 1:153119694-153119716 CCACCTGGGCGCTGTAGTGAAGG - Intergenic
915487244 1:156230213-156230235 TCACACTGATGCTGTACTGTAGG - Intronic
916527870 1:165628673-165628695 CCACCTGGACGCTATAGTGAAGG - Intergenic
916715620 1:167444498-167444520 TCTCCTGGGTGCTGTACTCTTGG - Intronic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
921307753 1:213814074-213814096 ACATGTGGATGCTGTACTCAAGG + Intergenic
922518292 1:226224056-226224078 TCACCTGGATCCTGGACTCGGGG - Exonic
924632471 1:245753686-245753708 TCATCTTCCTGCTGTACTGAAGG - Intronic
1063993128 10:11588244-11588266 TCAGCTGAATCCTGTACTGGAGG + Intronic
1065494159 10:26311997-26312019 TCACCTGCCTGCTGTCCTCAGGG - Intergenic
1069972360 10:72182868-72182890 TACCCTGGATCTTGTACTGAGGG + Intronic
1072952303 10:99858476-99858498 TCAACTGAAGGCTGTAGTGAGGG + Intergenic
1073646501 10:105309946-105309968 TGACATGGATGCTGTCCTCATGG + Intergenic
1077710226 11:4529209-4529231 TCTGCTGGATGCATTACTGAGGG - Intergenic
1078181091 11:9011466-9011488 TAGCCTGGATCCTGTACTGGAGG - Intergenic
1080233874 11:30046745-30046767 CCACCCAGATGCTGTACTCAAGG + Intergenic
1080266013 11:30402747-30402769 ATTCCTGGATGCTGTACTCATGG + Intronic
1083127768 11:60589634-60589656 TCAGCTGGTTGCTATACTGCTGG - Intergenic
1085295756 11:75430743-75430765 GAACCTGGATGCTGAACGGAGGG - Intergenic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1089299193 11:117488240-117488262 CCTCCTGGCTGCTGTACTGCTGG + Intronic
1089614118 11:119685587-119685609 ACACCTGGATTCTGTCCTGCAGG + Intronic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1096071637 12:48778617-48778639 TCTCCTGGGTGCTGTCCTTAAGG - Intronic
1100939399 12:99709242-99709264 ATACCTGCATGCTGTACTCATGG + Intronic
1107627213 13:42301261-42301283 TTACCTGGATTGTGTTCTGAAGG - Exonic
1108176634 13:47799047-47799069 TACCCTGAATGCTGCACTGAGGG - Intergenic
1108444438 13:50493178-50493200 TAACCTGGATTATATACTGAAGG - Intronic
1112956427 13:105064430-105064452 TCAACTGGATGCCACACTGAAGG - Intergenic
1113434975 13:110284091-110284113 GCACCTGGATGCTGTGGTGCAGG + Intronic
1114294614 14:21317789-21317811 TCAGCTGGATGCTGAGCTGGAGG + Exonic
1116400918 14:44505840-44505862 TCACCAAGAAGCTCTACTGAAGG + Exonic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1121943135 14:98092386-98092408 GCACCTGGATGCTTTCCAGAAGG - Intergenic
1125457417 15:39874308-39874330 TCACATGGATGATCTGCTGATGG + Intronic
1127763778 15:62165273-62165295 TCTCCTGGCCGCAGTACTGAAGG - Exonic
1130959795 15:88652292-88652314 TCACCTGGATGCTCTTGTGTAGG - Exonic
1131721845 15:95177946-95177968 TTATCTGGATCCTGCACTGAAGG - Intergenic
1132798430 16:1738680-1738702 TCACATGGATGCTACACGGACGG - Intronic
1134379922 16:13714304-13714326 TTTCCTGAATACTGTACTGAAGG - Intergenic
1140985325 16:80153085-80153107 TCTCCTGGATGCTGTTAAGAGGG - Intergenic
1141429752 16:83965485-83965507 TCACCGGGATGTTGTAGTGGCGG - Exonic
1146676665 17:34778410-34778432 GCACATGGCTGCTGGACTGAAGG + Intergenic
1150422912 17:65055436-65055458 TCATGTGGATCCTGTACAGATGG - Intronic
1151314375 17:73312426-73312448 CCACCTGGCTGCAGTACTGTCGG + Intergenic
1151616097 17:75213101-75213123 TTACCTGGCTGCTGAACTGGCGG - Exonic
1151986891 17:77549315-77549337 TCAACTGGATGCTGGACTCTAGG + Intergenic
1152358746 17:79820142-79820164 TCCCAGGGATGCTGTTCTGAAGG + Intergenic
1152855878 17:82664283-82664305 TCCCCGGGGTGCTGTGCTGATGG + Intronic
1161579401 19:5072385-5072407 TCTCCTGGCTTCTGGACTGAGGG + Intronic
1161777343 19:6270744-6270766 TCACCTGGACGGTGCACTGGAGG + Exonic
1164720531 19:30428731-30428753 TCAGATGGATGGTGCACTGAGGG + Intronic
1168585663 19:57589650-57589672 ACACCTGCATGCTGTGCAGAAGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925299974 2:2804768-2804790 TGAGATGGATGCTGTGCTGACGG + Intergenic
927567349 2:24124174-24124196 TCATCTGGAGTCTGTAGTGAAGG + Intronic
933995516 2:87665789-87665811 TATCCTGGAAGCCGTACTGAGGG + Intergenic
934608029 2:95712890-95712912 TCATCTGGAAGCTGTATTCAAGG - Intergenic
934846152 2:97662576-97662598 CCACCTGGAAGCTGGACTTAAGG + Intronic
935679739 2:105625649-105625671 TCACCTGCATGCCCTACAGATGG - Intergenic
936298339 2:111285126-111285148 TATCCTGGAAGCCGTACTGAGGG - Intergenic
937268059 2:120629743-120629765 CCTCCTGGAGGCTGTACGGACGG - Intergenic
945725274 2:213466854-213466876 TAACCTGGATGGTGTACTTCAGG - Intronic
948080876 2:235204079-235204101 GCACCTGGGTGCTGTGTTGAGGG - Intergenic
1173187467 20:40851630-40851652 TCCCCTGGTTTCTGTACTGGGGG - Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1173962832 20:47088467-47088489 GCCACTGGATGCTGTAATGATGG - Intronic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1178673031 21:34608553-34608575 TCATCTGAAGGCTGAACTGAAGG - Intronic
1178754850 21:35338859-35338881 TCACCTGGATGCTTTATGGTAGG - Intronic
1178961585 21:37071587-37071609 TCATCTGCAAGCTGTGCTGATGG + Intronic
1179171397 21:38975703-38975725 TTGCCTGGAGGCTGAACTGAAGG - Intergenic
1179272345 21:39861237-39861259 GCACCTGCACGCTGCACTGAGGG + Intergenic
1179962707 21:44779140-44779162 TCACCTGGAGGCGGCACTCAGGG + Intronic
1180299818 22:11028097-11028119 TCACCTGGAAACTCTACAGATGG + Intergenic
1180564902 22:16654845-16654867 TCACCATCATGCTATACTGATGG - Intergenic
1180864140 22:19106158-19106180 TCACCTCCATGCTTTACAGATGG - Intronic
1181806387 22:25376889-25376911 TCTCCTGGCAGCTGTGCTGAGGG - Intronic
1182218008 22:28735535-28735557 TTACTTGAATACTGTACTGAAGG - Intronic
1183473271 22:38021044-38021066 TGCCCTGGATGCTTTGCTGAGGG - Intronic
1184399905 22:44267706-44267728 CCACCTGGCTGCTCTTCTGATGG + Intronic
950237910 3:11339812-11339834 TCACGTGGGTTCTGTACTGCAGG + Intronic
950714478 3:14837998-14838020 TCAGCTGGGTCCTTTACTGAGGG + Intronic
953049781 3:39330185-39330207 ACACCTGGGTGCTGTTCTTAAGG + Intronic
954323502 3:49848139-49848161 TCACCTGGATTCGGCACTGTGGG + Exonic
955841437 3:63117004-63117026 TCACCTGGAAACTGTAAAGAGGG - Intergenic
956057376 3:65314519-65314541 TCTCCTGTATGCTGAGCTGACGG - Intergenic
959896440 3:111611922-111611944 TCTCCTTTATGCTGGACTGAAGG + Intronic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
965409116 3:168307359-168307381 GCACCTGGGTGCAGCACTGACGG - Intergenic
966296231 3:178427246-178427268 TCACCTGGATCCTCCACTGCTGG - Intronic
972678829 4:41286223-41286245 TAATCTAGATGCTGCACTGAAGG + Intergenic
972971280 4:44579226-44579248 GCACCTGAATGCAGAACTGAAGG + Intergenic
973343634 4:49031213-49031235 TGGCCTGGATGCTGTCCTCATGG + Intronic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
979446349 4:120816828-120816850 AAACCTCGATGCTGAACTGAAGG + Exonic
982843894 4:160224951-160224973 TCAGCTGGATGCTGTCATGGGGG + Intergenic
984164364 4:176289510-176289532 TCACGTGGATGTTGGTCTGATGG - Intergenic
984380002 4:178980797-178980819 TCACCTGGCTGATGTATTTAAGG + Intergenic
986064127 5:4219425-4219447 TCATCTGAAGGCTCTACTGAGGG + Intergenic
989049137 5:37301448-37301470 TCAGCTGGATTCTGAGCTGATGG - Exonic
989158802 5:38370532-38370554 TGACCTGGATGCCGTGCAGAAGG + Intronic
989250586 5:39309981-39310003 CCACCTGGAAGCTATATTGATGG - Intronic
991205175 5:64041835-64041857 TCACCTGACTGTTGTACTTATGG - Intergenic
995838364 5:116420679-116420701 TCAGCAGGATGTTGGACTGAAGG - Intergenic
998383368 5:141741693-141741715 TAGCCTGGAGGCTGAACTGAGGG + Intergenic
1000375284 5:160575276-160575298 TAAACTGGATTCTGTGCTGAAGG - Intronic
1002467208 5:179413590-179413612 GCACCTGGTGGCTGTGCTGAGGG - Intergenic
1005911950 6:30318493-30318515 CCCCCTGGATGCTGTTCTTATGG - Intergenic
1006394662 6:33779343-33779365 TCTGCTGGATGCAGTGCTGATGG + Intronic
1006837380 6:37007218-37007240 TGGCCCGGATGCTGTATTGAGGG + Intronic
1006938475 6:37735289-37735311 TTACCTGGGTGCTGTGCTCATGG - Intergenic
1007731321 6:43949182-43949204 TCACTGGGATGCTGGACTGCTGG - Intergenic
1008046270 6:46854454-46854476 GCACCTAGAGGCTCTACTGAAGG + Intronic
1008447493 6:51610082-51610104 TCACCTGGATTTTGTTCTTAGGG + Intergenic
1009318229 6:62250936-62250958 CAAGCTGGATGCTGTACTGAAGG + Intronic
1009614936 6:65991625-65991647 TTATCTGCATGCTGTTCTGATGG - Intergenic
1010269292 6:73903076-73903098 TCAGCTGGCTGCTGCACTGTGGG + Intergenic
1010300903 6:74257843-74257865 TCATCTGAAGGCTGGACTGAGGG - Intergenic
1014303613 6:119713595-119713617 TCTCCTGGTTGCTGTGCTCAGGG + Intergenic
1014723677 6:124950233-124950255 TTACCTGTATGCTGTATTGAAGG - Intergenic
1017440939 6:154463717-154463739 TCACCTTTTTGCTGTGCTGAGGG + Intronic
1019341334 7:510419-510441 TCACCTGGATGCTGCAGTGTTGG + Intronic
1023768562 7:43534082-43534104 TTGCCTGGGTGCTGCACTGAGGG + Intronic
1024190504 7:47002338-47002360 TCTCCTGGATGCTTTTCTTAGGG - Intergenic
1033709807 7:143930897-143930919 TCGCCTGGATACTGTACAGAAGG + Intergenic
1035742398 8:1938130-1938152 TCACCTGGATGCTTTAGGGGAGG + Intronic
1036012808 8:4746750-4746772 TGACCTCGCTGCTGTAGTGAAGG - Intronic
1037015151 8:13895655-13895677 TTACCTGGATATTGTACTCATGG - Intergenic
1037889922 8:22618670-22618692 CCTCCTGGCGGCTGTACTGAAGG - Exonic
1038441271 8:27572361-27572383 CCTCCTGGATTCTCTACTGATGG - Intergenic
1044255885 8:90060652-90060674 TGAACTGGATGCTTTACTGAAGG - Exonic
1047710912 8:127551458-127551480 TCCTCTGGCTGGTGTACTGAGGG - Intergenic
1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG + Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1058333112 9:103789802-103789824 TCAGCTGGAAGGTGTACCGAGGG - Intergenic
1059180415 9:112206987-112207009 TCCCCTGGAAGCTGAACAGAGGG + Intergenic
1059453203 9:114383619-114383641 TCCCCTGCATGCTGTGTTGAAGG + Intronic
1189760314 X:44315416-44315438 TGAGCTGGATGCTTTACTAAGGG + Intronic
1190734078 X:53243632-53243654 GCAACTGGCTGTTGTACTGAAGG - Intronic
1197532012 X:127640523-127640545 TCACCTGGTTTCTCTACTTAGGG + Intergenic
1200054348 X:153450992-153451014 ACATCAGGATGCTGAACTGATGG + Intronic
1200365250 X:155656165-155656187 TCTCCTGGATAATATACTGAAGG + Intronic