ID: 905416136

View in Genome Browser
Species Human (GRCh38)
Location 1:37805741-37805763
Sequence CCATTCCCAGACCTAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905416136_905416143 6 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416143 1:37805770-37805792 CATCGAATGGAGTTCTGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 64
905416136_905416146 14 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416146 1:37805778-37805800 GGAGTTCTGAGCAGGGATACGGG 0: 1
1: 0
2: 3
3: 12
4: 192
905416136_905416144 7 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416144 1:37805771-37805793 ATCGAATGGAGTTCTGAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
905416136_905416145 13 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416145 1:37805777-37805799 TGGAGTTCTGAGCAGGGATACGG 0: 1
1: 0
2: 3
3: 29
4: 262
905416136_905416147 26 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416147 1:37805790-37805812 AGGGATACGGGCTCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
905416136_905416140 -7 Left 905416136 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 905416140 1:37805757-37805779 GGAATGGAAAACCCATCGAATGG 0: 1
1: 0
2: 0
3: 37
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905416136 Original CRISPR CCATTCCCAGACCTAGAGTG GGG (reversed) Intronic
900507934 1:3038966-3038988 CCATTCCCAGCCCCAGGCTGCGG - Intergenic
902195673 1:14796234-14796256 CCATGCCCAGCCCTGGATTGAGG - Intronic
905231215 1:36515914-36515936 CATTTCACAGACCTAGAGAGGGG + Intergenic
905271563 1:36790918-36790940 CAGGTCCCAGACCTAGAGGGGGG + Intergenic
905416136 1:37805741-37805763 CCATTCCCAGACCTAGAGTGGGG - Intronic
906284920 1:44580981-44581003 CCATGCCCAGAGCCAGAGTCTGG + Intronic
906510875 1:46409941-46409963 TCATTCCCAGGGCCAGAGTGAGG - Intronic
906656738 1:47553776-47553798 CCATACCCATACCTGGATTGTGG + Intergenic
912103207 1:106237506-106237528 CTATTTCCAGAACTAGATTGGGG - Intergenic
913695064 1:121316910-121316932 GCATTCCCAGAACTATAGGGAGG - Intronic
914142497 1:144963148-144963170 GCATTCCCAGAACTATAGGGAGG + Intronic
915341169 1:155177591-155177613 GCATTCCCAGTGCTAGAGTGAGG + Intronic
916511625 1:165476788-165476810 CCATCCCATGACCTAGGGTGGGG - Intergenic
918555911 1:185799404-185799426 CCACTCTCAGCCCCAGAGTGGGG + Intronic
920482397 1:206335295-206335317 GCATTCCCAGAACTATAGGGAGG - Intronic
920941399 1:210486576-210486598 CCACACCCAGACCTTCAGTGTGG + Intronic
922444178 1:225682575-225682597 CCATTCCCAGCCATACAGTTTGG + Intergenic
924419684 1:243896565-243896587 GCTTTCCCAGAGCTACAGTGTGG - Intergenic
924460139 1:244251970-244251992 GAATTCCAAGCCCTAGAGTGTGG - Intergenic
924487913 1:244505258-244505280 ACATTCCCAGTCCTAGAATCAGG + Intronic
1067737555 10:48870044-48870066 CCATTCCCAGCCCTAGGGGGTGG + Intronic
1067998628 10:51305084-51305106 CCATCCCCAGACCTTCAGTAAGG - Intronic
1069747432 10:70724682-70724704 CCATCCCCAGCCCTTGAGTAGGG - Intronic
1069813943 10:71181562-71181584 CCAGCCCCAGACCTGGTGTGGGG + Intergenic
1069870766 10:71531596-71531618 CCCTTCCCAGCCCTAGGGTAGGG + Intronic
1070606537 10:77902212-77902234 TGATTCACAGACCTAGGGTGAGG + Intronic
1071275894 10:84054721-84054743 CCAGTCCCAGGCCTAGAGCCTGG + Intergenic
1072860096 10:98994638-98994660 CCAAACTCAGACCAAGAGTGAGG + Intronic
1076052270 10:127345378-127345400 CCAGTCCCACACCTAGAATGTGG + Intronic
1076508395 10:130994014-130994036 ACATTCCGAGACCCAGGGTGGGG + Intergenic
1076816846 10:132919250-132919272 CCCTTCCCACACCCAGAGGGCGG + Intronic
1077046972 11:551031-551053 CCTTTCCCAGACCCACCGTGGGG - Intronic
1078650946 11:13191583-13191605 CCATTCTCAGATCTGGAGGGCGG + Intergenic
1081181710 11:39992312-39992334 CCATTCTCAGATCTGGAGGGTGG - Intergenic
1081906653 11:46674574-46674596 CCTTTCCCAGACCTGCACTGGGG - Intronic
1084595254 11:70113024-70113046 CAATCCCCGGACCTACAGTGAGG - Intronic
1090385725 11:126356533-126356555 CCATTCCCAGTCCTGGGGGGAGG + Intronic
1090610584 11:128467231-128467253 CCCCTCCCAGACCTGAAGTGAGG - Intronic
1094053310 12:26243781-26243803 CAATGCCCAGAGGTAGAGTGTGG - Intronic
1095946657 12:47757811-47757833 CCAGTACCAGAGCTAGAGGGGGG - Intronic
1096310390 12:50515516-50515538 CCATGCCCAGCCCTACACTGTGG + Intronic
1096616717 12:52837259-52837281 CCGTTACCACACCTAGAGTGAGG - Intergenic
1107058110 13:36128602-36128624 CCCTCCCCAGACCTTCAGTGGGG - Intronic
1108072700 13:46644741-46644763 CCATGCCCAGGCCTACACTGGGG - Intronic
1112895091 13:104289058-104289080 ACATACCCACACCTAGCGTGTGG - Intergenic
1114250623 14:20957084-20957106 CCAGTGCCAGACCTAAAGTCAGG + Intergenic
1122044556 14:99014097-99014119 TCATTCTCAGATCTCGAGTGAGG - Intergenic
1122131554 14:99606802-99606824 GCATTCCCAGCCCTGGTGTGGGG - Intergenic
1122346627 14:101064984-101065006 TCATTCCCAGACCCTGAGAGGGG - Intergenic
1123039251 14:105483694-105483716 CCATGCCCAGGCTGAGAGTGTGG - Intergenic
1125919857 15:43518900-43518922 CCACTCCCAGGGATAGAGTGAGG + Intronic
1128874980 15:71194453-71194475 CCATGCCCCGACCCTGAGTGTGG - Intronic
1129256352 15:74336199-74336221 CCAGGCCCAGGCCCAGAGTGAGG - Intronic
1130028996 15:80295178-80295200 CCAGTCCCCGGACTAGAGTGGGG - Intergenic
1131929187 15:97419841-97419863 CCTGTCCCTGACCTTGAGTGTGG - Intergenic
1134349010 16:13418955-13418977 GCATTCCCAGAAATAAAGTGGGG + Intergenic
1134874584 16:17686279-17686301 CCATTCCCAGTCCTATTGTTTGG + Intergenic
1135424760 16:22326908-22326930 CCAGTGCCAGGCCTTGAGTGTGG + Intronic
1138212384 16:55174338-55174360 CCTATCCCAGACCCAGAGAGAGG - Intergenic
1139923647 16:70474260-70474282 CCCTTCTCATACCTGGAGTGTGG + Exonic
1141754293 16:85981077-85981099 ACATTCACAGTCCTGGAGTGGGG - Intergenic
1142850571 17:2702697-2702719 CGTTTCCTAGCCCTAGAGTGGGG - Intronic
1143382237 17:6503666-6503688 CCATCCCAAGCTCTAGAGTGAGG - Intronic
1144943762 17:18959433-18959455 CCTTGCCCAGACCTAGAGAGGGG + Intronic
1146473793 17:33145464-33145486 CCTTGCCCAGCCCTAGAGGGTGG + Intronic
1151956265 17:77381620-77381642 CCATTCCCTGACCTTTAATGGGG - Intronic
1151989532 17:77565352-77565374 CCATTCCCGGAGCTGGGGTGGGG - Intergenic
1155607513 18:27624216-27624238 CCATTGCCCAAGCTAGAGTGTGG - Intergenic
1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG + Intronic
1156380850 18:36559805-36559827 CCCTTCCCAGACCTTGGGAGGGG - Intronic
1156504281 18:37579307-37579329 CCATTACCAGACAGTGAGTGTGG - Intergenic
1156720561 18:40064402-40064424 CAATTCCCATCCCTCGAGTGAGG - Intergenic
1157380409 18:47209809-47209831 CCATGCCCAGCCTTAGAATGTGG - Intergenic
1159011054 18:63058708-63058730 CCATTCCCAGACCAGGACGGAGG + Intergenic
1160008605 18:75087537-75087559 CCACTCCCCGACCAAGAGCGCGG - Intergenic
1161766010 19:6209307-6209329 CCATTCCCAGCATCAGAGTGTGG - Intergenic
1162023274 19:7878735-7878757 CCCTTCCCTGCTCTAGAGTGGGG + Intergenic
1163917361 19:20252867-20252889 CCATTCCCTGACCTGGAGGAAGG - Intergenic
1164250587 19:23471319-23471341 CCATTCCCTGGCCAAGGGTGTGG + Intergenic
1164324130 19:24177877-24177899 CCATTCCCTGGCCCAGAGTGAGG - Intergenic
1164489377 19:28692656-28692678 CCATTCTCAGATCTGGAGTTTGG - Intergenic
1166106243 19:40599499-40599521 CCAGTCCCAGCCCCAGCGTGAGG + Exonic
1166300041 19:41908074-41908096 CCTTCCCCAGCCCCAGAGTGGGG - Intronic
1167290098 19:48619787-48619809 CCCTTCCCTGACCTAGAAAGAGG + Intronic
925008569 2:465239-465261 CCATTCCTAGCCCTGGAATGTGG + Intergenic
925768368 2:7259324-7259346 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768379 2:7259368-7259390 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768392 2:7259412-7259434 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768404 2:7259456-7259478 CCATTCCTGGACACAGAGTGTGG + Intergenic
925795770 2:7540814-7540836 CCATCCACAGCCCTACAGTGTGG + Intergenic
928371724 2:30744807-30744829 CCATCCCTAGAACTAGAGTCAGG - Intronic
929340779 2:40814418-40814440 CCATTACCAGACCTACATAGTGG - Intergenic
930484879 2:51999105-51999127 CCATTCCGGGGCCTGGAGTGTGG - Intergenic
932128355 2:69165496-69165518 CCAGTCCCAGTCACAGAGTGAGG + Intronic
936977154 2:118231820-118231842 CCTTTCCTAGACCCATAGTGTGG - Intergenic
939530857 2:143359899-143359921 TCATTCCCAAACCTAAAATGAGG + Intronic
941781132 2:169447017-169447039 CCATCCCCAGACCTCTAGGGAGG + Intergenic
948072597 2:235140019-235140041 CGATGCCCAGACCTGGAGTTCGG + Intergenic
948566979 2:238893676-238893698 CGAATCCCAGACATACAGTGTGG + Intronic
1168736053 20:137773-137795 CCATTCTCAGCCCCAAAGTGGGG - Intergenic
1172807776 20:37625123-37625145 CCAGGCCCAAACCTAGAGGGTGG - Intergenic
1173658011 20:44714466-44714488 CCTTGCTCAGACCAAGAGTGAGG - Intergenic
1179990825 21:44947476-44947498 CACTTCCCAGGGCTAGAGTGGGG - Intronic
1182001499 22:26923602-26923624 CCAGTCCCTGACCCAGAATGTGG + Intergenic
1183066492 22:35367079-35367101 CCAATCCCAGTCTTAGAGTCTGG + Intergenic
1183262937 22:36807664-36807686 CCATTCCCACACCTGGAAAGTGG - Intronic
1185217480 22:49609760-49609782 CCATTCCCTGGCCTGGGGTGGGG - Intronic
950256126 3:11507775-11507797 TCCTTCCCACATCTAGAGTGTGG - Intronic
951159987 3:19407620-19407642 CCATTCCTAGACATAGATAGTGG + Intronic
952122490 3:30262063-30262085 CCAATCCCAGAACTAGAATAGGG + Intergenic
952715972 3:36481499-36481521 CCATCCACAGACCCAAAGTGAGG - Intronic
954451160 3:50572423-50572445 CCATTGCCAGACCTAGAGGCTGG - Intronic
961440178 3:126948121-126948143 CGTTTCCCAGAAGTAGAGTGGGG - Intronic
964971769 3:162572003-162572025 TAATTCACAGACCTAGATTGTGG + Intergenic
969567377 4:7986579-7986601 CCAGGCCCAGAACTAGAGTGAGG - Intronic
970668175 4:18362256-18362278 CCTTTCCCAGTCCTAGAATCAGG + Intergenic
974146292 4:57952169-57952191 TCATTCCTAGACCTAGAAAGTGG - Intergenic
976210865 4:82668403-82668425 ACATTCCCAGACCCAAACTGGGG + Intronic
977095601 4:92739659-92739681 CCTTTTCCTGACCTAGAGTGGGG - Intronic
979381471 4:120011596-120011618 CCATCCCCAGACATAGAAGGCGG - Intergenic
983444453 4:167831861-167831883 TCTTTTCCAGACCTAGAATGAGG + Intergenic
985933116 5:3074489-3074511 CCTTTCCGAAGCCTAGAGTGTGG - Intergenic
986610393 5:9561347-9561369 GCATTGACAGACCTAGATTGTGG + Intergenic
989264211 5:39454349-39454371 CCATTCTCAGACCAAGGGTGCGG + Intronic
991252249 5:64576697-64576719 CCATTCCTGGAGCTAGAGGGTGG + Intronic
993016901 5:82544643-82544665 CCATTCTCAGATCTGGAGGGTGG - Intergenic
994259989 5:97646165-97646187 CCATTCCCAGAGCTACACAGAGG - Intergenic
1000914441 5:167063355-167063377 CCAGTCCTAGACCTTGAGTTTGG - Intergenic
1003171503 6:3724933-3724955 CCATGGCCAGGCCTGGAGTGTGG + Intronic
1003936087 6:10976684-10976706 CCATTCCCAGCCCTACACTCAGG + Intronic
1004590888 6:17050568-17050590 CCATCCCCCAACCTAGAGGGAGG + Intergenic
1009724940 6:67526415-67526437 CCATGCCAATACCTAGTGTGAGG - Intergenic
1018185766 6:161264460-161264482 CCACTTCCAGACCTAACGTGGGG + Intronic
1020548350 7:9564648-9564670 ACATTTCCAGACTTAGAGTTTGG + Intergenic
1035386913 7:158479181-158479203 CCATTCACAGCCTTAGGGTGAGG - Intronic
1038988113 8:32835612-32835634 CCCTACCAAGACCTAGAGTCTGG + Intergenic
1039247314 8:35623210-35623232 CCATTCCCATACCAAGCCTGGGG + Intronic
1043521420 8:81049937-81049959 CCATCCCCAGTCCCAGCGTGGGG - Intronic
1045727057 8:105186226-105186248 CCCTTCCTGGACCTAGATTGTGG - Intronic
1046313814 8:112474281-112474303 CCAACCCCCGAACTAGAGTGGGG + Intronic
1047448366 8:124939583-124939605 CCATGCCCAGACCAAAAATGGGG - Intergenic
1047566286 8:126047364-126047386 CCCTTCCTAGACATAGATTGTGG - Intergenic
1053394926 9:37764779-37764801 CCATTCCCAGAACTCTAGTGTGG - Intronic
1058820432 9:108724396-108724418 TCATTCCCAGCCCTAGAGGATGG + Intergenic
1062710740 9:137973956-137973978 CCCCTCCCAGATCTAGGGTGTGG + Intronic
1203791310 EBV:153227-153249 CCATTCTAAGACCCAAAGTGAGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192547421 X:72025718-72025740 ACATTTCCAGACCTGGGGTGTGG + Intergenic
1193867873 X:86759051-86759073 CCATTCCCATGCCCAGACTGTGG + Intronic
1195078547 X:101349741-101349763 GCATTCCCAGATGTAGAGAGGGG + Exonic
1200039118 X:153353261-153353283 CCATTCCCAGTCCCTGAGGGAGG - Intronic