ID: 905416493

View in Genome Browser
Species Human (GRCh38)
Location 1:37808027-37808049
Sequence CGCCCGGCTGTTGCGGCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905416493_905416499 -9 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416499 1:37808041-37808063 AGCCGGGCGCCGGGGGCCGCCGG 0: 1
1: 0
2: 6
3: 67
4: 501
905416493_905416509 10 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416509 1:37808060-37808082 CCGGAGCGGGACTCGGCGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 173
905416493_905416504 3 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416504 1:37808053-37808075 GGGGCCGCCGGAGCGGGACTCGG 0: 1
1: 0
2: 0
3: 14
4: 229
905416493_905416501 -4 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416501 1:37808046-37808068 GGCGCCGGGGGCCGCCGGAGCGG 0: 1
1: 0
2: 0
3: 47
4: 434
905416493_905416507 7 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416507 1:37808057-37808079 CCGCCGGAGCGGGACTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 89
905416493_905416502 -3 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416502 1:37808047-37808069 GCGCCGGGGGCCGCCGGAGCGGG 0: 1
1: 0
2: 0
3: 52
4: 458
905416493_905416511 28 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416511 1:37808078-37808100 GGCGGAAGAGGCGACCGCTCCGG 0: 1
1: 0
2: 1
3: 8
4: 85
905416493_905416510 16 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416510 1:37808066-37808088 CGGGACTCGGCGGGCGGAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 126
905416493_905416505 6 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416505 1:37808056-37808078 GCCGCCGGAGCGGGACTCGGCGG 0: 1
1: 0
2: 0
3: 13
4: 124
905416493_905416512 29 Left 905416493 1:37808027-37808049 CCGGGAGCCGCAACAGCCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 905416512 1:37808079-37808101 GCGGAAGAGGCGACCGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905416493 Original CRISPR CGCCCGGCTGTTGCGGCTCC CGG (reversed) Exonic
900767646 1:4515848-4515870 CTCCAGGCTCTGGCGGCTCCAGG - Intergenic
902203168 1:14848950-14848972 GGGCCGGATGCTGCGGCTCCAGG + Intronic
902214302 1:14924619-14924641 CGCCCGGCCCCGGCGGCTCCTGG - Intronic
904684138 1:32248532-32248554 GGCCCCGCTGCTGCGGCACCTGG + Exonic
905416493 1:37808027-37808049 CGCCCGGCTGTTGCGGCTCCCGG - Exonic
906678336 1:47708981-47709003 CCCCCGCCTGCTGCGGCTCCCGG + Intergenic
912447928 1:109751686-109751708 TCCCCGGCTGTAGGGGCTCCAGG + Exonic
912576095 1:110674294-110674316 CGGCCGGCGGATGCGGCCCCCGG + Exonic
913205282 1:116532891-116532913 AGACCGGCTGTCGCGACTCCGGG - Intronic
913615798 1:120558497-120558519 CGGCCGGCCGCTGCTGCTCCGGG - Intergenic
914574477 1:148952405-148952427 CGGCCGGCCGCTGCTGCTCCGGG + Intronic
915599781 1:156914829-156914851 CACCTGGCTGTTGCTGCTCAAGG + Exonic
918388748 1:184037005-184037027 CGCCCTGCAGCTGCTGCTCCGGG + Intronic
1063134180 10:3201990-3202012 TGCCCGGCTGTGGGGGCTCCAGG - Intergenic
1069895452 10:71677672-71677694 CACACAGCTGGTGCGGCTCCGGG + Intronic
1070742897 10:78914065-78914087 GGCCCGGCTGCTGCCGCTGCTGG + Intergenic
1073403453 10:103277101-103277123 CGCCCGGCTTTTAAGGCGCCGGG - Intergenic
1073412108 10:103350887-103350909 CTCCCGGCTGCTCCGGCTCCCGG - Exonic
1076395647 10:130136108-130136130 CTCCTGGCTGTAGGGGCTCCTGG - Intergenic
1076706881 10:132307299-132307321 CCCGCGGCTGTGGCGTCTCCGGG - Intronic
1076806113 10:132859663-132859685 GGCCCTGCTGTGGCTGCTCCGGG - Intronic
1076993857 11:289135-289157 CGCCCGGCTGCCGCGCCACCAGG - Exonic
1077012353 11:384929-384951 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012367 11:384967-384989 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012381 11:385005-385027 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012395 11:385043-385065 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012409 11:385081-385103 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012423 11:385119-385141 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012437 11:385157-385179 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012451 11:385195-385217 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012465 11:385233-385255 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012479 11:385271-385293 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012493 11:385309-385331 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012507 11:385347-385369 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012521 11:385385-385407 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012535 11:385423-385445 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012549 11:385461-385483 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012563 11:385499-385521 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012577 11:385537-385559 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012591 11:385575-385597 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012605 11:385613-385635 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1077012619 11:385651-385673 TGCCCGGCTGTGGGGGTTCCAGG - Intergenic
1078987058 11:16607063-16607085 GGCCCGGCAGCCGCGGCTCCCGG + Intronic
1079128434 11:17734590-17734612 CGCGCGGCTCCTGCTGCTCCCGG - Intergenic
1087672992 11:101128476-101128498 AGCCCGGCAGCTGCTGCTCCCGG - Exonic
1092508553 12:9128476-9128498 GGCCCAGCTGGTGCGGATCCAGG + Intergenic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1098202359 12:68069225-68069247 GGCCCAGCTGATGCTGCTCCAGG + Intergenic
1100565427 12:95790276-95790298 CGCGCGGCTGCTGCTGCTCTGGG - Exonic
1102140900 12:110614114-110614136 CGCCTGGCTGTCGCGGTTGCCGG + Intronic
1103856245 12:123972894-123972916 CGCCCGGCTGTGGCGGGGCAGGG + Intronic
1105512299 13:21061135-21061157 CGCCGGGCGGGGGCGGCTCCGGG + Intronic
1114270789 14:21098603-21098625 CGGCCGCCTCTCGCGGCTCCCGG - Exonic
1122425178 14:101601611-101601633 CGCCAGGCTGTCCAGGCTCCTGG + Intergenic
1122975214 14:105168220-105168242 CGCGCGGCGGCTGGGGCTCCGGG - Intronic
1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG + Intronic
1131056711 15:89379205-89379227 GGCTCGGCGGCTGCGGCTCCGGG - Intergenic
1134206570 16:12243011-12243033 CCCCTGGCTGTGGAGGCTCCTGG + Intronic
1136460455 16:30407399-30407421 CGCCGGGCTGGGGCGGCTCCAGG + Exonic
1137491321 16:48935437-48935459 CTCCGGGCTGTTGCCTCTCCAGG - Intergenic
1139451365 16:67029891-67029913 GGCGCGGCTGCTGCGGCTCCCGG + Intronic
1139489254 16:67278023-67278045 CCCCCGGCTCTTAGGGCTCCTGG + Exonic
1140440641 16:74985024-74985046 CGCCCGGCCGCCGCGGCCCCAGG + Exonic
1141205659 16:81931540-81931562 CGCCCTGCTGCTTGGGCTCCAGG - Exonic
1141430589 16:83968699-83968721 GGCCCTGCTGCGGCGGCTCCCGG - Exonic
1142474538 17:181277-181299 CGCCCGGCTGTGGCCGGTGCCGG - Exonic
1143779448 17:9221676-9221698 CGCCAGGCTGTAGCGGGGCCGGG + Intronic
1147121034 17:38335195-38335217 CGGGCGGCTGCTGCGGCACCTGG - Exonic
1147996719 17:44363663-44363685 CGCGCGGCTGTTGCCGCTGCTGG - Exonic
1151155671 17:72121913-72121935 CGCCCGGGAGTTGCCGTTCCGGG + Intronic
1152633187 17:81419898-81419920 CGCCCGCCTCTCCCGGCTCCCGG + Intronic
1152741444 17:82020185-82020207 GGCCCCGCTGCTGGGGCTCCAGG + Intronic
1152800415 17:82328250-82328272 CGCCAGGCAGAGGCGGCTCCAGG + Intronic
1161568103 19:5014616-5014638 GGCCAGGCTGTTGAGACTCCTGG + Intronic
1161767354 19:6214973-6214995 CTCCCGGCTCTGGCAGCTCCAGG + Intronic
1161818837 19:6516760-6516782 CACCCGGCAGGTGCGGCTCCTGG - Intergenic
1164109132 19:22138088-22138110 CTCCCGGCTGCTCCGGCTCCCGG + Intergenic
1165199832 19:34134627-34134649 CGCACGTTTGTCGCGGCTCCTGG + Intergenic
1166374013 19:42316866-42316888 CGCGTGGCTGATGCGGCCCCTGG - Exonic
926185827 2:10689988-10690010 TGCCCGCGTGTTCCGGCTCCAGG - Intergenic
934709941 2:96508263-96508285 CTCCCGGCTTTGGGGGCTCCCGG - Intergenic
935622824 2:105144083-105144105 CCCCCGGCAGCTGCGGCTCGGGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942186783 2:173431740-173431762 CTCCCGGGTTTTGCGGCTGCTGG - Intergenic
946622377 2:221573346-221573368 CGCCCGGCTGCTCCGGCCCCGGG + Intronic
947524773 2:230871403-230871425 CCCCCGTCTCTTGCTGCTCCCGG + Intronic
947593775 2:231398777-231398799 CATGCGGCTGTTGCGGTTCCGGG - Exonic
948843685 2:240672767-240672789 CGCGCGGCTCCAGCGGCTCCGGG - Intergenic
1169130802 20:3165577-3165599 GGCCCGGCTGATGCGGCAGCGGG - Exonic
1172890611 20:38261022-38261044 AACCCGGCTGCTGCGGCTCGAGG - Intronic
1175872838 20:62216558-62216580 CGCCTGGCTGCTGGGGCTGCTGG - Exonic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1181108129 22:20586608-20586630 CTCCAGGCTGCTGCAGCTCCCGG + Exonic
1182144622 22:27989905-27989927 CGTCCAGCTGTGGCGGCTCCCGG - Exonic
1184746429 22:46458731-46458753 CGCCCGCCTGGTGCTGCACCTGG + Intronic
960602111 3:119468931-119468953 CGCCCACGTGCTGCGGCTCCCGG + Exonic
968323461 3:197791584-197791606 CCCCCGGCCGGGGCGGCTCCCGG - Intronic
968565716 4:1311588-1311610 AGCCAGGCTGCTGCGGCTGCAGG - Intronic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
996738431 5:126777580-126777602 CACGCGCCTGTCGCGGCTCCAGG + Exonic
999248223 5:150166822-150166844 CGGCCGGCAGCGGCGGCTCCAGG + Exonic
999372369 5:151063834-151063856 CGCCTGGCTTCTGAGGCTCCAGG + Intronic
999743802 5:154576576-154576598 CTCCTGGCTGTGGCGGCCCCAGG - Intergenic
1001589925 5:172858234-172858256 CGGCCGGCTGAAGCGGCTGCTGG + Intronic
1016994835 6:149954454-149954476 CGCCCTCCTGTAGCGGCCCCAGG + Intergenic
1017003770 6:150014982-150015004 CGCCCTCCTGTAGCGGCCCCAGG - Intergenic
1018836510 6:167488253-167488275 CCCCCGGCAGGTGCGGCTCTGGG + Intergenic
1020012698 7:4815382-4815404 CGCCCGCCTGCAGCAGCTCCTGG - Exonic
1020099897 7:5388860-5388882 CGCGCGGCTGCTGCGGCGCACGG - Exonic
1023881306 7:44323136-44323158 TGCCCTGCTGTGGCGGCTCTTGG - Intronic
1025020349 7:55475392-55475414 CGCCCGGCAGTGGAGGCTGCCGG - Intronic
1032398530 7:131607908-131607930 AGCCCCTGTGTTGCGGCTCCCGG - Intergenic
1035778609 8:2209415-2209437 CCCCCGGCTGTTGAGGATTCTGG - Intergenic
1039885132 8:41650154-41650176 CGCCCAGCAGTTCCGGGTCCGGG + Intronic
1040415098 8:47188725-47188747 CTCCAGGCAGTGGCGGCTCCCGG - Intergenic
1040415111 8:47188773-47188795 CTCCCAGCGGTGGCGGCTCCTGG - Intergenic
1041714705 8:60922878-60922900 CTCCCCGCTGTTTCGGGTCCTGG - Intergenic
1042155848 8:65842650-65842672 CGCCTGGCAGATGCGGCCCCGGG + Intergenic
1042512579 8:69626732-69626754 CGGCCGGCCCTTGCGGCCCCGGG - Intronic
1044629165 8:94262317-94262339 CGCCCGGCCGCGGCGGCTGCAGG - Exonic
1045305178 8:100951810-100951832 CGCCCCGCGGTGGCGGCGCCGGG - Intronic
1049096186 8:140549598-140549620 CTCGCGGCTGTGGCGGCCCCAGG + Intronic
1049565259 8:143334831-143334853 GGTGCGGCTGCTGCGGCTCCGGG - Exonic
1056178345 9:84057652-84057674 CACCAGGCTGCTGCAGCTCCAGG + Intergenic
1057245753 9:93452467-93452489 CGCCCGGCCGTGGCGGCGCTGGG + Exonic
1060918530 9:127405041-127405063 GGCCCTGCTGTGGCGGCTCCCGG + Intronic
1061506466 9:131034435-131034457 CCAACCGCTGTTGCGGCTCCAGG - Intronic
1062639974 9:137514162-137514184 CACCCGGCTGTTGAGGTGCCCGG + Intronic
1062640111 9:137514592-137514614 CACCCGGCTGTTGAGGTGCCCGG + Intronic
1195327907 X:103773012-103773034 CCCCCGGCTGTTGTTGCTCAGGG + Intergenic
1199772463 X:150983657-150983679 CGCCCGCCCGTGGCGGCCCCAGG + Intronic