ID: 905418289

View in Genome Browser
Species Human (GRCh38)
Location 1:37820032-37820054
Sequence TTCACTCAGCACCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905418286_905418289 10 Left 905418286 1:37819999-37820021 CCTAAATATCTGAAAAGAAAATG 0: 1
1: 0
2: 9
3: 97
4: 1006
Right 905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG 0: 1
1: 0
2: 2
3: 16
4: 193
905418285_905418289 11 Left 905418285 1:37819998-37820020 CCCTAAATATCTGAAAAGAAAAT 0: 1
1: 0
2: 21
3: 145
4: 1499
Right 905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG 0: 1
1: 0
2: 2
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905418289 Original CRISPR TTCACTCAGCACCCCAGGAC AGG Intronic
900112553 1:1014647-1014669 TTCACTTGGCAGCCCAGGCCTGG - Intergenic
900184306 1:1325756-1325778 GTTGCTCAGCACCCTAGGACTGG - Intronic
900491974 1:2954663-2954685 TTGACTCAGTTCCTCAGGACTGG + Intergenic
900659973 1:3777385-3777407 TTCAGACCGCAGCCCAGGACAGG - Intergenic
900827131 1:4935781-4935803 GTCACTCAGCAGGCCAGAACTGG + Intergenic
901371235 1:8799666-8799688 TCCAATCCGCAGCCCAGGACAGG + Intronic
904360764 1:29970333-29970355 TTCACAAAGCACCCCAGGAGGGG - Intergenic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
905864573 1:41369716-41369738 TGCAGTCAGCACCCAGGGACTGG + Intronic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
914434813 1:147650403-147650425 TTCACAGAGGACCCCAAGACCGG - Intronic
916211849 1:162366137-162366159 TACACTCAGTACCCCTGGGCTGG + Intronic
917695076 1:177514126-177514148 TTCAACCAACATCCCAGGACAGG + Intergenic
917732594 1:177891255-177891277 CTCACCTAGCAACCCAGGACAGG + Intergenic
917912788 1:179668559-179668581 TTCACTGAGCACCCCGTGTCGGG - Intronic
918009845 1:180576657-180576679 TTCACCCTGCACCCTTGGACCGG + Intergenic
922277030 1:224088675-224088697 TACACTCAGCACCTCAGGACAGG + Intergenic
1065788130 10:29235364-29235386 CTCACTCAACAACTCAGGACTGG - Intergenic
1067222815 10:44356401-44356423 GTCTCTCACCATCCCAGGACAGG + Intergenic
1071692017 10:87830513-87830535 TTCATTCAGCACCATAAGACAGG - Intronic
1071788994 10:88934759-88934781 TACACTCATAACCCCAGTACTGG - Intronic
1072533174 10:96338806-96338828 TTCCCTAAGCATCCCAGCACAGG + Intergenic
1073531056 10:104232279-104232301 CGCACGCAGCACCCCAGGGCGGG + Exonic
1073626005 10:105097771-105097793 TTCACAAAGCAGCCCAGGTCAGG - Intronic
1074273393 10:111977284-111977306 TTGCCTCAGCACACCTGGACAGG - Intergenic
1075211802 10:120497623-120497645 TTCACTCAGCACCATAAGACAGG - Intronic
1075253358 10:120903005-120903027 TGCACTCAGCACACCTGGCCTGG - Intronic
1075292189 10:121240269-121240291 ATAACTCAGAACCCCATGACTGG + Intergenic
1075570570 10:123538798-123538820 TTCACTGAGCTTCCCTGGACAGG + Intergenic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076893362 10:133296036-133296058 CACACTCAGCATCCCAGGAAAGG - Intronic
1077043324 11:534046-534068 TCGTCTCAGCACCCCAGGAGAGG - Intronic
1077176581 11:1193827-1193849 TTCACTCAGCACCCCTAAGCGGG - Intronic
1078248049 11:9594320-9594342 GTCTCTCATCACCCCAAGACAGG - Intergenic
1079088713 11:17465511-17465533 AGCACTCAGCACTGCAGGACAGG - Intronic
1080458624 11:32435623-32435645 TTCACTCAGCAGCCCAAGCCCGG + Exonic
1083460203 11:62806057-62806079 TTGACTCAGCAACTCAGGGCGGG - Intronic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1085741031 11:79078579-79078601 TTCACACAACACACCAGGACTGG + Intronic
1087037902 11:93773064-93773086 TTCACTCTGGTTCCCAGGACTGG + Intronic
1088612579 11:111592010-111592032 TTTATTCAGCACCACAGGAGTGG - Intergenic
1089704503 11:120267945-120267967 TTCACATAGCTCTCCAGGACTGG - Intronic
1090254646 11:125274909-125274931 TTATCTCTGCACCCCGGGACTGG - Intronic
1091452268 12:580254-580276 TTCATTCAGCACTCCAGGTGAGG - Intronic
1091842769 12:3632558-3632580 TGCACTTAGCACCCCATGAGAGG - Intronic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1096978141 12:55712054-55712076 TTCACTCACCTCTCCAGCACTGG + Intronic
1097245638 12:57606186-57606208 TCCACTCAGCTGACCAGGACTGG - Exonic
1097288442 12:57895144-57895166 TCCACTCTGCCTCCCAGGACAGG - Intergenic
1098422630 12:70317846-70317868 TTACCTCAGCACCACAAGACAGG + Intronic
1101150950 12:101881962-101881984 CTCACTCTTTACCCCAGGACAGG + Intronic
1102721822 12:115023110-115023132 TTCACTCAGCCACGCAGGATAGG + Intergenic
1104663305 12:130628012-130628034 TTCATTCAGGACCTCAGGGCTGG - Intronic
1104729005 12:131094857-131094879 AGCTCTCAGCAGCCCAGGACAGG - Intronic
1105673128 13:22642452-22642474 TTCCTTCATCTCCCCAGGACTGG - Intergenic
1105867723 13:24475323-24475345 TTCACTGAGCACTCCATGCCAGG - Intronic
1108472851 13:50784828-50784850 TTCACTCAGAGCTGCAGGACAGG - Intronic
1110302425 13:73944835-73944857 TACAGTCAGCAACCCAGGAAGGG + Intronic
1112103588 13:96216809-96216831 TTCATTCAGCACACTAAGACAGG + Intronic
1112715891 13:102184384-102184406 GTCACTCAGCATCCCAGGGATGG + Intronic
1112880875 13:104104878-104104900 TTCTCTCCCCACCCCAGGCCTGG - Intergenic
1113215796 13:108039483-108039505 CTCACTCAGCACACAAGGACTGG + Intergenic
1113563541 13:111303186-111303208 TGCACTCAGGACCACAGGGCAGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114612025 14:24048987-24049009 TCCACTCTGCACCTCAGGAAAGG - Intergenic
1121215225 14:92242509-92242531 CTCACTCCTCACCCCAGGCCTGG + Intergenic
1121514982 14:94543612-94543634 CTGACTCAGCAGGCCAGGACGGG - Intergenic
1121574843 14:94975644-94975666 GCCACTCATCAGCCCAGGACAGG + Intergenic
1123025894 14:105423878-105423900 TGCACTCAGCACTCCAGGGTAGG - Intronic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1124229909 15:27935527-27935549 ATCTCTCAGCACCCCAGCCCAGG + Intronic
1124514281 15:30352990-30353012 TCCTCTCAGAACCCCAGGCCAGG + Intergenic
1124728638 15:32177774-32177796 TCCTCTCAGAACCCCAGGCCAGG - Intergenic
1129335187 15:74847841-74847863 TTCCCTCACCTCCCCTGGACAGG - Intronic
1132255774 15:100374190-100374212 CTCACGCAGCAGCCCAGGATTGG - Intergenic
1132518055 16:375066-375088 TTCACTCAGGACCACAGGCCGGG - Intronic
1132519287 16:379971-379993 TTCACTCAGGTTCCCAGGACAGG - Intronic
1134190708 16:12119138-12119160 TTCTCTCAACAACTCAGGACTGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135636265 16:24078287-24078309 TTTACTCAGCACCCAAGCAAGGG + Intronic
1138607554 16:58098675-58098697 TTCAGCCAGCAGCCCAGGGCAGG + Intergenic
1139340612 16:66265630-66265652 CTGGCTCAGCACTCCAGGACAGG - Intergenic
1140896201 16:79326792-79326814 TTTTCTCAGCACCCTAGGTCAGG - Intergenic
1141350258 16:83288251-83288273 CTCACACAGCACTCAAGGACAGG - Intronic
1142617049 17:1142811-1142833 TTCACTCAGGACCCTCGGCCTGG + Intronic
1148328002 17:46795141-46795163 TTCCCTCAGCACCCGAGGGTGGG - Intronic
1151426754 17:74035694-74035716 TGCACTAAACACCCCAGGGCTGG - Intergenic
1151718775 17:75844358-75844380 TTCACCCAGCACCAGCGGACAGG - Exonic
1152412344 17:80133889-80133911 CTCACTCAGCAAGCCAGGACAGG + Intergenic
1152507721 17:80762255-80762277 TTCCTGCAGCACCCGAGGACGGG - Intronic
1154360602 18:13657326-13657348 TTCACTGTGGACCCCTGGACCGG + Intergenic
1155760341 18:29557715-29557737 TTCACTCAGCACCATAAGACAGG - Intergenic
1157569383 18:48702418-48702440 TTCACTCAGGAACCCCGGACAGG - Intronic
1160033083 18:75279071-75279093 TTCTCCCACCACCCCAGGCCAGG - Intronic
1160439152 18:78875914-78875936 TTCACTGAGCATCCCATGAAGGG - Intergenic
1161176557 19:2846073-2846095 TACACTGAGAACCCTAGGACAGG - Intronic
1162190979 19:8946595-8946617 TTCACTCCTCACCCCAGGCATGG - Exonic
1165390458 19:35535680-35535702 TTTAATCAGCACTCCAGGCCGGG - Intronic
1166835327 19:45664188-45664210 TTCCCTCTCCACTCCAGGACAGG + Intergenic
1167094514 19:47367178-47367200 ATCACTCAGGGCCCCAGGAGCGG + Intronic
1167206248 19:48104650-48104672 CTCACTCAGGACCCCAAGGCAGG + Exonic
1167371740 19:49086567-49086589 TTCACTGAGCAGGCCAGGAATGG + Intronic
1167853450 19:52219632-52219654 TGCACACAGCAACCCAGGACAGG - Intronic
1168258929 19:55181985-55182007 GTCCCTCAGCAACACAGGACGGG - Intronic
925021614 2:574049-574071 TTCTCCCAGCACACCAGCACAGG - Intergenic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
928139017 2:28711639-28711661 CTAACTCAGCACCCCAGGACAGG + Intergenic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
931554865 2:63491402-63491424 TTCACTGATCAGCCAAGGACTGG + Intronic
931741487 2:65249670-65249692 TTGACTGAGCACCCCTTGACTGG - Intronic
932400215 2:71475321-71475343 TTCATTCAGCACCCGATTACTGG + Intronic
934716736 2:96549117-96549139 AGCTCTCAGCGCCCCAGGACAGG - Intronic
935640518 2:105285655-105285677 TTCACTCAGCACCATAAGACAGG + Intronic
938860880 2:135367291-135367313 TTCTCTCAACAACTCAGGACTGG + Intronic
940403797 2:153277567-153277589 TTGACCCAGCACCCCATTACTGG - Intergenic
941892037 2:170592603-170592625 TTCAAACAGCACCCAGGGACAGG - Intronic
942391098 2:175493868-175493890 CTCACTCACCACCCCACAACAGG + Intergenic
942438853 2:176010739-176010761 TTCACTAAGCTCCTCAGGGCAGG - Intergenic
943809437 2:192165989-192166011 TTCAGTGAACACCCGAGGACTGG - Intronic
943935974 2:193917851-193917873 TTGACTCAGCATCCCATTACTGG - Intergenic
947667588 2:231916890-231916912 TCCACTCAGAGTCCCAGGACTGG + Intergenic
948359389 2:237408476-237408498 TTGATTCAGCAGCCCAGGGCCGG - Intronic
948912046 2:241009676-241009698 TGCATTCAGCGCCCCCGGACAGG - Intronic
949003951 2:241634789-241634811 TTCACTCTGTTCCCCAGGATGGG - Intronic
1169509657 20:6249816-6249838 TGCCCTCATCACCCCAGGGCTGG - Intergenic
1170212496 20:13859571-13859593 AACACTCAGAACCCCAGAACTGG + Intronic
1170582655 20:17710860-17710882 TTCCCGCAGCAACCCAGGGCTGG + Intronic
1170766252 20:19291961-19291983 TTCCCTCATGACCCCAAGACAGG - Intronic
1172277077 20:33685823-33685845 GTCACCCCGCACCCCAGGGCGGG + Intronic
1172626056 20:36347491-36347513 TTTCCACAGCACCCCAGCACAGG - Intronic
1175487827 20:59357914-59357936 TTCAAGCAGAACCCCAGGAGAGG + Intergenic
1175698631 20:61121485-61121507 TTCCTTCCGCAGCCCAGGACAGG - Intergenic
1177859129 21:26432312-26432334 TTCACACACCACCACATGACAGG + Intergenic
1180262310 21:46680509-46680531 TTCCCTAATCACCCCAGGGCCGG + Intergenic
1184555958 22:45233228-45233250 TTCACTCAGATGCCCAGGTCGGG + Intronic
1184644597 22:45889194-45889216 AGCACTGAGCCCCCCAGGACAGG + Intergenic
1184806250 22:46796632-46796654 TCCACCCAGCAACCCGGGACCGG - Intronic
949441074 3:4081189-4081211 TTCACTGAGCAGGTCAGGACAGG + Intronic
950526623 3:13528294-13528316 GTCACTCTGAACCCCAGGTCTGG + Intergenic
952026181 3:29085752-29085774 TTCACTCTGCCACCCAGGCCTGG + Intergenic
952620769 3:35338778-35338800 TTCACTCAGCACCACAGCTGTGG - Intergenic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
955552737 3:60101397-60101419 TTCTTTCAGCTCCCCAGGACTGG + Intronic
956488527 3:69747043-69747065 ATCACTCTGAATCCCAGGACAGG - Intronic
959625239 3:108442366-108442388 TTCACTGAAAACCCCAGAACAGG + Intronic
964335461 3:155649571-155649593 ATCACACAGCACCCTGGGACAGG + Intronic
965512313 3:169581812-169581834 TTCAAAAAGCACACCAGGACAGG - Intronic
967557539 3:190876671-190876693 ATCACTCAGGGCCCCAGGAGCGG + Intronic
969644052 4:8416224-8416246 TCCTCTCTGCACCCCAGGACAGG - Intronic
971550909 4:27954405-27954427 TTCATTCAACACCTCAGAACTGG - Intergenic
978549814 4:109913391-109913413 GTCTCTCAGCACCGCAGCACTGG + Exonic
979628020 4:122868268-122868290 TTCACTCCCCACCCCACAACAGG + Intronic
981593411 4:146390674-146390696 TTCAATCAGAATCCTAGGACTGG + Intronic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
983163188 4:164442863-164442885 TCCACTCAGCTCCCCAGTGCTGG - Intergenic
984231279 4:177102819-177102841 TCCACTCCGCACCCCCCGACAGG - Intergenic
989373170 5:40731456-40731478 TTGACTCAGTACCACAGGGCTGG + Intronic
993244829 5:85437428-85437450 ATCCCTCCCCACCCCAGGACAGG - Intergenic
996270160 5:121595237-121595259 TCCAGTCAGCACAGCAGGACTGG - Intergenic
996450008 5:123610326-123610348 TACACTCATCAACCCAGGTCAGG + Intronic
997663112 5:135604454-135604476 ATCCCTCAGTGCCCCAGGACTGG - Intergenic
998216575 5:140242155-140242177 TCCACTCAGCAGCACAGGTCTGG - Intronic
1002171740 5:177378511-177378533 TTCCTTCAGCTCCCCAGCACTGG - Intergenic
1002319462 5:178366291-178366313 TTCCCTCTGCACCCCACGATGGG + Intronic
1002671182 5:180868832-180868854 CTCACTCACCTCCCCAGGATTGG + Intergenic
1002693692 5:181070252-181070274 TCCACTCAGGTCCGCAGGACTGG + Intergenic
1013188466 6:107782403-107782425 CACACTCAGCCCCCCGGGACCGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017817888 6:158028303-158028325 TTGACTCAGGACCCCTGGCCTGG - Intronic
1018039445 6:159909105-159909127 TTTACTCAGCACTCCAGGGGGGG + Exonic
1018995333 6:168705754-168705776 AGCACACAGCACCCCAGGGCGGG + Intergenic
1018995345 6:168705790-168705812 AGCACACAGCACCCCAGGGCGGG + Intergenic
1019100926 6:169628627-169628649 TTCTCTCATCCTCCCAGGACAGG + Intronic
1019537453 7:1536775-1536797 TTCTCTCAGGAACCCAGCACGGG - Intronic
1021656806 7:22881177-22881199 GTCACTCCACACCCCAGCACTGG + Intergenic
1021901574 7:25290763-25290785 TTTACTCAGCCCCCCACCACTGG - Intergenic
1022193189 7:28037041-28037063 TTCCCTCTGCACCCCAGTAAGGG - Intronic
1022530512 7:31063995-31064017 TTAACTCAAAACCCCAGGGCAGG - Intronic
1023338756 7:39197131-39197153 TTTCCTCACCTCCCCAGGACAGG + Intronic
1024757066 7:52546678-52546700 TTCAGTCAGGGCACCAGGACAGG - Intergenic
1027045953 7:74991559-74991581 CCCACTCAGCAGCCCAGGCCAGG + Intronic
1029386870 7:100249012-100249034 CCCACTCAGCAGCCCAGGCCAGG - Intronic
1030226371 7:107156098-107156120 TTCACTCCCCACCCCCTGACAGG - Intronic
1030607691 7:111655439-111655461 TTCACTCATCACCCAGGGAATGG + Intergenic
1032532723 7:132635609-132635631 ATTCCTCAGCTCCCCAGGACGGG + Intronic
1033973271 7:147069111-147069133 TTCACTCATCACCCGGGGAAGGG + Intronic
1034529995 7:151689671-151689693 TGCAGCCAGCACCCCAGGAAGGG - Intronic
1035046295 7:155969526-155969548 TTCTCTCTGCACCCCTGGAATGG + Intergenic
1035204905 7:157289003-157289025 CTCACTCAGGAGCTCAGGACAGG - Intergenic
1035539563 8:422263-422285 TTCACACAGCACCACACCACAGG - Intronic
1037419838 8:18690534-18690556 AACACTCTACACCCCAGGACAGG + Intronic
1039788624 8:40856089-40856111 TTCACACAGGCCCACAGGACAGG + Intronic
1039947099 8:42139795-42139817 TTCACCCAGCCCCCAGGGACGGG + Intergenic
1041314192 8:56544566-56544588 TTCCCTAATCACCCCAGGGCAGG + Intergenic
1045483857 8:102614637-102614659 TTGACTCCCCACCCCCGGACAGG - Intergenic
1046817394 8:118599526-118599548 TTTACTGAGCACCCCACGAGCGG - Intronic
1049154861 8:141060269-141060291 TCCACTCAGGACCCCAGAATGGG - Intergenic
1049358879 8:142202419-142202441 TACACACAGCAGACCAGGACAGG - Intergenic
1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG + Intronic
1052916819 9:33929459-33929481 TGCAGTCAACTCCCCAGGACAGG + Intronic
1060523960 9:124310045-124310067 TTCACTCAAGACCCCCTGACCGG - Intronic
1060993963 9:127865344-127865366 TGCACTCAGCTGCCCAGAACTGG + Intergenic
1185455627 X:309274-309296 CTCACTCAGCACCCTACGGCCGG + Intronic
1190486143 X:50927193-50927215 TTCACCCAGCACCCTAGCACAGG - Intergenic
1192156158 X:68748138-68748160 TTCAATCAGCACCCCTGGGGTGG + Intergenic
1199627954 X:149757978-149758000 GGGACCCAGCACCCCAGGACAGG - Intergenic
1199628719 X:149761866-149761888 GGGACCCAGCACCCCAGGACAGG - Intergenic
1199675885 X:150189028-150189050 TTCCCTCAACAGCCCAGGCCTGG + Intergenic
1199947436 X:152680278-152680300 GGCACCCAGGACCCCAGGACAGG + Intergenic
1199962244 X:152788176-152788198 GGCACCCAGGACCCCAGGACAGG - Intergenic
1200257767 X:154593825-154593847 GTCTCTCAGAAGCCCAGGACAGG - Intergenic
1202048371 Y:20756446-20756468 TTGACTCCGCAGCCCAGCACTGG + Intronic