ID: 905423610

View in Genome Browser
Species Human (GRCh38)
Location 1:37865499-37865521
Sequence GGGTGATAGATCAACGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905423605_905423610 13 Left 905423605 1:37865463-37865485 CCAAGCTAAGTGCAATGAGAATG 0: 1
1: 0
2: 1
3: 5
4: 116
Right 905423610 1:37865499-37865521 GGGTGATAGATCAACGAGACTGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905423610 Original CRISPR GGGTGATAGATCAACGAGAC TGG Intronic
902966171 1:20004809-20004831 AGAAGATAGATCAACAAGACAGG + Intergenic
905423610 1:37865499-37865521 GGGTGATAGATCAACGAGACTGG + Intronic
906379897 1:45326169-45326191 GGGTGATTGAAGAAAGAGACAGG + Intergenic
908181383 1:61609622-61609644 GGGTGCTTGATCAAGGAGGCTGG + Intergenic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
1065006571 10:21386003-21386025 GGGTCATAGAACTAGGAGACAGG + Intergenic
1067732055 10:48819618-48819640 TGTTGGGAGATCAACGAGACAGG - Intronic
1072298781 10:94038853-94038875 GGGTGATAGCTAAAAGAAACAGG - Intronic
1073997487 10:109332589-109332611 GGGTGAGAGATAAAGGAGAGAGG - Intergenic
1074564400 10:114564178-114564200 GGAAGATAGAGCAACGAGGCCGG - Intronic
1090887783 11:130894400-130894422 GGGTGAAAGATCAAAGAAACAGG + Intronic
1095840285 12:46684956-46684978 GGGTTGTAGAGCAAGGAGACAGG + Intergenic
1096826867 12:54285913-54285935 GGGTGATAGTTCCATGATACTGG + Intronic
1099442964 12:82720194-82720216 GGGTGATAGCTAAAAGATACAGG - Intronic
1103108888 12:118256768-118256790 GGGTGATAGCTAAAAGATACAGG + Intronic
1106121801 13:26865949-26865971 GGCTGATAGACCAATGAGGCAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1111662443 13:91228142-91228164 GGGTGGTAGAGCAAGGAGTCTGG - Intergenic
1112732690 13:102383785-102383807 GGGTGATACATGAATCAGACAGG - Intronic
1121781354 14:96624395-96624417 GGGTGAGAGAGGAAGGAGACGGG - Intergenic
1137816445 16:51402192-51402214 GTGTGATAGATCAATGGGATTGG - Intergenic
1138873405 16:60920434-60920456 AGGTGATAGATCATGGAGGCAGG - Intergenic
1142754676 17:2009084-2009106 GGGTGATGTATCAATGAGACAGG + Intronic
1166055951 19:40288977-40288999 GGGTGATCGATCGAGGCGACTGG + Intergenic
925206629 2:2012866-2012888 AGGTGATAGAGCACCGAGGCCGG + Intronic
927997963 2:27499518-27499540 GGAAGATAGATCAATGAGATCGG + Intronic
930191360 2:48463360-48463382 GGGTGATGTATCAAGGCGACTGG + Intronic
941334371 2:164223464-164223486 GGGTGATACATCAACCAGTGGGG - Intergenic
942382256 2:175404044-175404066 GGGGGATATATTAAGGAGACAGG + Intergenic
948082326 2:235216381-235216403 GGTTGATAGTTCAAGGACACAGG + Intergenic
1168821364 20:775687-775709 AGGTGAAAGATCAAAGGGACAGG - Intergenic
1178756279 21:35353195-35353217 TGGTGAGAGACCAAGGAGACTGG - Intronic
971379135 4:26080933-26080955 GGGTGATAAATCATCAAGATAGG + Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
981478240 4:145209814-145209836 GGGTGCTAGACCAAAGAGAATGG - Intergenic
982788003 4:159558666-159558688 GGGTGATTGAGCCAGGAGACTGG - Intergenic
993234308 5:85283434-85283456 GAGTCATAGATCAAAGATACAGG + Intergenic
993294512 5:86118910-86118932 GGGTGATAATTAAAAGAGACTGG + Intergenic
998375323 5:141686874-141686896 GGGAGACAGATCAAAGAGACAGG + Intergenic
1002779985 6:358510-358532 GGGTGTCAGAGCAACCAGACTGG + Intergenic
1009287531 6:61839720-61839742 GGGTGAAAGATCAAGAACACAGG + Intronic
1033728899 7:144153379-144153401 AGATGATAGATTAACTAGACAGG + Intergenic
1045607355 8:103791998-103792020 AAGAGACAGATCAACGAGACAGG + Intronic
1047849832 8:128844778-128844800 GGGTGAGAAAGCAACGAAACAGG - Intergenic
1050056461 9:1660545-1660567 GTGAAACAGATCAACGAGACAGG - Intergenic
1192153547 X:68726638-68726660 AGGTGATAGAGCAGCGGGACTGG - Intergenic
1196008421 X:110859991-110860013 GGGTGATAGCTAAAGGATACAGG + Intergenic
1199583750 X:149389097-149389119 GGGTGACAGATAAAGGATACAGG + Intergenic
1199995707 X:153024521-153024543 TGGTGATAGACCAGCAAGACTGG - Intergenic