ID: 905426522

View in Genome Browser
Species Human (GRCh38)
Location 1:37889663-37889685
Sequence CTCCTCCACTATCACAGTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905426522_905426525 5 Left 905426522 1:37889663-37889685 CCGACACTGTGATAGTGGAGGAG 0: 1
1: 0
2: 0
3: 22
4: 151
Right 905426525 1:37889691-37889713 CATGTCAGTAATTTCGGACTTGG 0: 1
1: 0
2: 0
3: 5
4: 50
905426522_905426526 20 Left 905426522 1:37889663-37889685 CCGACACTGTGATAGTGGAGGAG 0: 1
1: 0
2: 0
3: 22
4: 151
Right 905426526 1:37889706-37889728 GGACTTGGATTTATTCTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 160
905426522_905426523 -1 Left 905426522 1:37889663-37889685 CCGACACTGTGATAGTGGAGGAG 0: 1
1: 0
2: 0
3: 22
4: 151
Right 905426523 1:37889685-37889707 GCGAACCATGTCAGTAATTTCGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905426522 Original CRISPR CTCCTCCACTATCACAGTGT CGG (reversed) Exonic
903218770 1:21857348-21857370 CTCCTCCACAGTCACTGTGATGG + Exonic
903557246 1:24202857-24202879 CCCATCCCCTATCACAGGGTAGG - Intergenic
903885139 1:26536758-26536780 CACCTCCACTTTCATGGTGTAGG - Intronic
905426522 1:37889663-37889685 CTCCTCCACTATCACAGTGTCGG - Exonic
907166234 1:52413948-52413970 CTCCTCCTGTAGCGCAGTGTGGG - Exonic
908575749 1:65458046-65458068 TTGCTCCAGTATCACATTGTTGG - Intronic
911318078 1:96378684-96378706 GTCCCCCACTATTACTGTGTTGG - Intergenic
913077297 1:115351974-115351996 CTCCTCCACTCTCATTTTGTTGG + Intergenic
913222265 1:116668599-116668621 CTCCCCCAATAACACAGGGTTGG - Intergenic
917454293 1:175172601-175172623 CTCCACCACTAACATGGTGTGGG + Intronic
920177201 1:204109242-204109264 CTCACCCACTTTCAAAGTGTAGG - Intronic
920206105 1:204293071-204293093 CTCCCCCACTCCCACAGTGTGGG - Intronic
924834284 1:247633302-247633324 GTCTCCCACTATTACAGTGTGGG + Intergenic
1063678326 10:8161937-8161959 CTCCTTCTGTAGCACAGTGTGGG - Intergenic
1064522024 10:16212306-16212328 CTTCCCCACTATCACATTCTAGG + Intergenic
1068810256 10:61247717-61247739 CTGCTCCACTAGCACAGTGAAGG - Intergenic
1070422876 10:76254763-76254785 CTCTTCCACTGTCACATTCTGGG + Intronic
1070764217 10:79047304-79047326 CTCCTCCAGCAGCCCAGTGTAGG - Intergenic
1072177494 10:92942909-92942931 CTCCTCCACTATTACTTTGGAGG - Intronic
1072298947 10:94040457-94040479 TTCCTCAACCATCACTGTGTTGG - Intronic
1073030797 10:100524134-100524156 CTCCTTCTCTCTCACAGTGTAGG - Exonic
1077316620 11:1922204-1922226 CTCCTCCAAGATCACAGAGCAGG - Intronic
1077380592 11:2235197-2235219 CTCCTCCTGTGTCACACTGTGGG - Intergenic
1077400748 11:2355681-2355703 CTCCTCCTGTGTCACACTGTGGG - Intergenic
1077799866 11:5526904-5526926 CTCCTAGACTGTCACAGTCTAGG + Intronic
1077966712 11:7141811-7141833 CACGTCCACAATCTCAGTGTTGG - Intergenic
1079580112 11:22053755-22053777 GTCTCCCACTATTACAGTGTGGG + Intergenic
1080040430 11:27754175-27754197 CTCCTCAACTCTCACGGTGTGGG - Intergenic
1080875770 11:36272939-36272961 CTCATCTACTATAACAGAGTTGG - Intergenic
1080908877 11:36575082-36575104 CTCCTTCACCACCACAGTGAAGG - Exonic
1082101060 11:48173329-48173351 CTCCTCCACTGTAGCAGGGTTGG + Intergenic
1082665116 11:55966544-55966566 CTCCTCCAAAATCACAACGTTGG + Intergenic
1083666120 11:64275689-64275711 CTCCTCCACTAGCTCTGAGTGGG + Intronic
1089190929 11:116652784-116652806 CACCACCATTATCACAGTGCTGG - Intergenic
1090062653 11:123477326-123477348 CCCCTCCCCTAGCACAGTGCTGG + Intergenic
1091534330 12:1391404-1391426 GGCCTCCACTAACACAGTGGGGG + Intronic
1091850206 12:3690766-3690788 GTCTTCCACTATTATAGTGTGGG + Intronic
1092478013 12:8835607-8835629 CTCAGCCACTGCCACAGTGTAGG - Exonic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1093917483 12:24821797-24821819 TTCCTCCAGTTTCACAGTGCTGG - Intronic
1094100948 12:26761543-26761565 CACCTCCACTTCCAAAGTGTTGG - Intronic
1098033426 12:66278261-66278283 CTCCTGGACTATCCCAGTTTAGG - Intergenic
1098087955 12:66868283-66868305 CTTCTCCTCTATCTCAGTGGTGG - Intergenic
1102211094 12:111127899-111127921 CTTATTCACTATCACAGTATGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103341089 12:120221548-120221570 CTCCTCCCTTACCTCAGTGTGGG - Intronic
1103804336 12:123560643-123560665 CTCCTTCACTTTGACAGTCTTGG + Intergenic
1109881167 13:68478941-68478963 CTCCTCCCCTATCACATATTGGG - Intergenic
1110799495 13:79678580-79678602 CCACTCCACTCTCAAAGTGTGGG + Intergenic
1113144377 13:107191595-107191617 CTCCACGACTTTCACAGTGTTGG + Intronic
1114371796 14:22097642-22097664 CTCCTTCAATCTCATAGTGTTGG + Intergenic
1115357429 14:32463135-32463157 CTCTCCCACTATTACTGTGTGGG - Intronic
1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG + Intergenic
1116554043 14:46280207-46280229 GTTTTCCACTATCACATTGTAGG - Intergenic
1119925145 14:78486567-78486589 CTCTTCCACCATCCCAGGGTGGG - Intronic
1120300787 14:82703964-82703986 GTCTCCCACTATCACTGTGTGGG + Intergenic
1121592609 14:95128407-95128429 CTACTTCACCACCACAGTGTTGG + Intronic
1122566965 14:102665986-102666008 CACCTTCTCTATCACAGTTTAGG - Intronic
1123111980 14:105876259-105876281 CACCACCACTATGACAGTGCTGG + Intergenic
1123776192 15:23583076-23583098 CTCCACAACTTTCTCAGTGTGGG - Intronic
1124562779 15:30791275-30791297 CCCCTCCCCTCTCACAGAGTGGG + Intergenic
1128461679 15:67873575-67873597 CACCTCCATTATCACAGAGCAGG - Intergenic
1132104267 15:99051410-99051432 CTGCCCCACTATCCCAGGGTGGG - Intergenic
1133422254 16:5655986-5656008 GTCAGCCACTTTCACAGTGTTGG + Intergenic
1143250999 17:5522930-5522952 CTCCTCCTCCAGCACTGTGTGGG + Intronic
1143924908 17:10361073-10361095 CTGCTCCAGTATCACAGACTGGG - Intronic
1143973112 17:10810133-10810155 CTCCTCCTTTTTCTCAGTGTGGG + Intergenic
1146794862 17:35773815-35773837 CTCCTCCACTCTGACACTGCAGG - Intronic
1148185368 17:45639488-45639510 CAGCTCCAGTGTCACAGTGTGGG - Intergenic
1149073201 17:52568423-52568445 CTCCTCAACTATAATAGTTTTGG + Intergenic
1149234670 17:54575986-54576008 CTCCTCCTCTATAAAAGTGAAGG + Intergenic
1150931604 17:69590758-69590780 CTCCTCAACTCCCACATTGTTGG - Intergenic
1151397716 17:73835210-73835232 CTCATTCACTATCACACTGCAGG - Intergenic
1152922606 17:83073427-83073449 CTTCTTCACTATCTCAGCGTGGG + Intergenic
1160268159 18:77358824-77358846 CTCCCCCATTATCAGATTGTGGG + Intergenic
1161351776 19:3797012-3797034 ATCCTGCACTTTCACAGTGGTGG + Intronic
1162180622 19:8866352-8866374 CTCCTCCCCTATCCCAGTTCAGG + Intronic
1163396211 19:17063385-17063407 CTCATTCAATATCACAGTGGAGG + Intronic
1164102395 19:22068727-22068749 CTACTCCAGTATCACATTTTAGG - Intronic
1168240185 19:55085004-55085026 CTCCTCCATTTTCACAGAGGAGG - Intronic
1168344766 19:55644756-55644778 CTCGTCCACCAGCACTGTGTAGG - Exonic
924972616 2:142670-142692 CTCGCCCACCATCACAGTGAAGG + Intergenic
926541769 2:14189325-14189347 GTCTTCCACTGTGACAGTGTAGG + Intergenic
927463081 2:23316146-23316168 CTCCACCACTTTCACTGGGTTGG + Intergenic
928023772 2:27723456-27723478 TTCCTCCACTTTCACAGTAGGGG + Intergenic
929674411 2:43910986-43911008 CTCCTTCATTATCACAGAGAGGG + Intronic
931288235 2:60850279-60850301 CTCCTTCAAGATCACAGTTTGGG - Intergenic
931908794 2:66871533-66871555 TTCCCCTACTATCACAGTTTGGG - Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
936616822 2:114056397-114056419 CTCCTCCCTTCTCACAGTGGGGG - Intergenic
937621530 2:123993390-123993412 CTCTCCCACTATTACTGTGTGGG - Intergenic
942236566 2:173914318-173914340 CTCCCCCAATCTCACAGTTTAGG + Intronic
942450146 2:176104106-176104128 CTCCCCCACTATCACTGAGGGGG - Intergenic
945666971 2:212755309-212755331 GTCCCCCACTATTACTGTGTGGG - Intergenic
946015849 2:216603228-216603250 CTCCCCCACCCTCCCAGTGTAGG - Intergenic
1170824310 20:19780564-19780586 CATTTCCACTAACACAGTGTTGG - Intergenic
1171095209 20:22326285-22326307 TTCCTCATATATCACAGTGTGGG + Intergenic
1173629801 20:44503880-44503902 CTACTCCACCATCAAAGAGTGGG - Exonic
1174277389 20:49413844-49413866 CTCCTCCAATATCCCAGACTGGG + Intronic
1175514247 20:59558879-59558901 CTCCTCCCTTATCACCATGTTGG + Intergenic
1177035539 21:16038288-16038310 CTCCTCCAAAATCACATAGTTGG - Intergenic
1177313465 21:19426687-19426709 GTCTTCCACTATCATTGTGTGGG - Intergenic
1179375743 21:40848459-40848481 CTCCTCCACTACCCCGATGTGGG + Intergenic
1182031154 22:27160427-27160449 CTCCTGCCCTGTCACTGTGTGGG + Intergenic
949846361 3:8374420-8374442 CTCTTCCACTATTATTGTGTGGG - Intergenic
950792303 3:15482240-15482262 CACCACTCCTATCACAGTGTTGG - Intronic
950905967 3:16538651-16538673 CTCCTCCACTTCCCTAGTGTGGG + Intergenic
951105878 3:18742030-18742052 CCCCTCCATTAACAGAGTGTTGG + Intergenic
951906421 3:27712337-27712359 CTCCTCCACTCCAACTGTGTGGG + Intergenic
952481200 3:33763615-33763637 CTCTGACACCATCACAGTGTTGG + Intergenic
952616978 3:35285537-35285559 GTCCTCCACTATTATTGTGTTGG - Intergenic
952992659 3:38845128-38845150 CTCCTCAATGATCACAATGTAGG + Intergenic
954932004 3:54291714-54291736 CTGCTCCACGATCACAGTTTGGG - Intronic
961504790 3:127362842-127362864 CTCCTCCACCAGCTCAGAGTTGG - Intergenic
968826273 4:2899968-2899990 CTGCCCTCCTATCACAGTGTGGG - Intronic
971610242 4:28714757-28714779 CTCATTCATCATCACAGTGTAGG - Intergenic
974504048 4:62745107-62745129 CTCTTCCACTATTATTGTGTGGG - Intergenic
976562571 4:86519219-86519241 GTCCTCCACTATTATTGTGTTGG + Intronic
976819755 4:89192305-89192327 TTACTACACTCTCACAGTGTAGG + Intergenic
977274005 4:94952866-94952888 CTCTGCCACTATTATAGTGTGGG + Intronic
977572138 4:98639642-98639664 TTACTCCAATATCACAGTGTAGG + Intronic
980583260 4:134782405-134782427 GTCTTCCACTATTATAGTGTGGG + Intergenic
980664283 4:135908547-135908569 GTCTTCCACTATCATTGTGTGGG + Intergenic
981157153 4:141451915-141451937 CTCCTCCAATATCATTGTATTGG + Intergenic
991469657 5:66954544-66954566 GTCTTCCCCTATCAGAGTGTAGG - Intronic
993140974 5:84033126-84033148 CTGATCCACTATTCCAGTGTAGG + Intronic
995266537 5:110168176-110168198 CCCCTCCACTATCACCATCTTGG - Intergenic
999697711 5:154201247-154201269 CTCCACCAGTATCACGGTGGAGG + Intronic
1001272009 5:170319934-170319956 CTGCTCCACTCTCACATTTTTGG + Intergenic
1007432571 6:41785320-41785342 CACCTCCCCTCTGACAGTGTAGG + Exonic
1008482937 6:52005624-52005646 CTCTTCCCCTCTCACAGAGTAGG - Intronic
1009020917 6:57947513-57947535 CTCCTGCACCTTCACAGTGAAGG - Intergenic
1009616953 6:66021655-66021677 CTCTTCTACTTTCACATTGTTGG + Intergenic
1009678319 6:66856998-66857020 ATCCTCCAGTGTCAGAGTGTGGG - Intergenic
1010482974 6:76377096-76377118 GTCTTCCACTATCACTGTGTGGG + Intergenic
1011756952 6:90509489-90509511 CTGCTTCACGATGACAGTGTAGG - Intergenic
1014046485 6:116893946-116893968 CTCCTTCACTAACACAGAGCTGG + Intronic
1014514943 6:122366561-122366583 CACTGCCACTCTCACAGTGTCGG - Intergenic
1014545212 6:122727264-122727286 CACCTCCACTACCACAGTATTGG - Intergenic
1014552973 6:122810276-122810298 CTTCTCCACTATGCCAGTGTTGG - Intergenic
1017567299 6:155701352-155701374 CTCCTCCAATTCCTCAGTGTGGG - Intergenic
1022394113 7:29970266-29970288 CCCCTCCACTCTCACAATGCCGG + Intronic
1023814217 7:43937291-43937313 CACCTCCACTATCACTGTGCAGG - Intronic
1029018805 7:97342286-97342308 CACCTCCACTGTCACATTGCAGG + Intergenic
1029192105 7:98779206-98779228 ATCTTCCACAACCACAGTGTGGG - Intergenic
1032505512 7:132431497-132431519 CTCCTTCCCTCTCACAGTGTTGG - Intronic
1033448625 7:141442978-141443000 CTCTTCCAAGATCACAATGTTGG + Intronic
1039970360 8:42316750-42316772 CTCATCCTCTGTCACAGGGTAGG - Exonic
1045087584 8:98703199-98703221 CTCCTCCACTTGCACTGAGTTGG + Intronic
1047809694 8:128395039-128395061 CTCCTCCACTGCCAGAATGTTGG + Intergenic
1049176856 8:141197988-141198010 CTCCTCCACCACCAAAGTGAAGG - Intergenic
1049812295 8:144580905-144580927 CTCCTGCGCTTTCTCAGTGTCGG + Exonic
1052105945 9:24516289-24516311 CTTGTCCACCATCACAGTGAAGG - Intergenic
1056873006 9:90302594-90302616 CTCCCCCTCTATCACTGTCTGGG - Intergenic
1189668208 X:43380454-43380476 CTTCCCCACTTTCACAGTTTGGG - Intergenic
1189881905 X:45502924-45502946 CTCCTCCAAGATCACAGAGCAGG - Intergenic
1190197266 X:48330022-48330044 CTCCTTCACTATTACAGTGAAGG + Intergenic
1190658790 X:52635834-52635856 CTCCTTCATTATTACAGTGAAGG + Intergenic
1190663999 X:52680394-52680416 CTCCTTCACTATTACAGTGAAGG + Intronic
1190675423 X:52778028-52778050 CTCCTTCACTATTACAGTGAAGG - Intronic
1191933630 X:66402574-66402596 GTCTTCCACTATTACTGTGTGGG + Intergenic
1191949385 X:66572006-66572028 CTACCCCACTGTGACAGTGTTGG + Intergenic
1192686250 X:73308307-73308329 GTCTTCCACTATTACTGTGTGGG - Intergenic
1193585173 X:83311988-83312010 ATCCAGCACAATCACAGTGTTGG + Intergenic
1193997720 X:88386996-88387018 GTCCCCCACTATCATTGTGTGGG - Intergenic
1196461274 X:115934828-115934850 CACCACCACTATGACTGTGTTGG + Intergenic
1197319359 X:125008415-125008437 CTCCTACACAATAACAGTGAAGG + Intergenic
1198982049 X:142409042-142409064 CTCCACCACTATCACTGTGCTGG - Intergenic
1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG + Intergenic
1200264100 X:154636610-154636632 CTCCTCCGGTAGCACAGTGTAGG - Intergenic
1202270929 Y:23073403-23073425 CTCCTCCGCTATCCTAGTGTGGG + Intergenic
1202295097 Y:23347279-23347301 CTCCTCCGCTATCCTAGTGTGGG - Intergenic
1202423924 Y:24707147-24707169 CTCCTCCGCTATCCTAGTGTGGG + Intergenic
1202446865 Y:24962938-24962960 CTCCTCCGCTATCCTAGTGTGGG - Intergenic