ID: 905426694

View in Genome Browser
Species Human (GRCh38)
Location 1:37891257-37891279
Sequence GTAAGTTGTCCCAGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905426694_905426702 30 Left 905426694 1:37891257-37891279 CCAGCTACCCTGGGACAACTTAC 0: 1
1: 0
2: 0
3: 18
4: 94
Right 905426702 1:37891310-37891332 GGAGAACCTCAGTCCTACAAGGG 0: 1
1: 1
2: 1
3: 19
4: 135
905426694_905426697 -7 Left 905426694 1:37891257-37891279 CCAGCTACCCTGGGACAACTTAC 0: 1
1: 0
2: 0
3: 18
4: 94
Right 905426697 1:37891273-37891295 AACTTACATTATACCCAAAATGG 0: 1
1: 0
2: 0
3: 12
4: 224
905426694_905426700 9 Left 905426694 1:37891257-37891279 CCAGCTACCCTGGGACAACTTAC 0: 1
1: 0
2: 0
3: 18
4: 94
Right 905426700 1:37891289-37891311 AAAATGGTCTCAGTACTGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 208
905426694_905426701 29 Left 905426694 1:37891257-37891279 CCAGCTACCCTGGGACAACTTAC 0: 1
1: 0
2: 0
3: 18
4: 94
Right 905426701 1:37891309-37891331 AGGAGAACCTCAGTCCTACAAGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905426694 Original CRISPR GTAAGTTGTCCCAGGGTAGC TGG (reversed) Intronic
900139279 1:1132726-1132748 GTCCGGTGTCCCAGGGTTGCCGG + Intergenic
902580069 1:17402570-17402592 GTAAGATGTCCTGGGGTAGCTGG - Intergenic
905426694 1:37891257-37891279 GTAAGTTGTCCCAGGGTAGCTGG - Intronic
905871776 1:41408489-41408511 GTCTGTTGTCACAGGGTGGCTGG - Intergenic
912167767 1:107060438-107060460 GTAAGTTGTTTGAGGGAAGCAGG - Intergenic
913309356 1:117472495-117472517 GTAAGTTCTCCAAGGGTATTAGG - Intronic
915483204 1:156201347-156201369 GGTGGATGTCCCAGGGTAGCAGG - Intronic
916090264 1:161303153-161303175 AAATGTTGTCCCAGGGTACCAGG + Intergenic
922003911 1:221509201-221509223 ATAAATTGTCCCGGGTTAGCTGG + Intergenic
1063257265 10:4342132-4342154 GAAAGATGTCACTGGGTAGCAGG + Intergenic
1063845703 10:10124781-10124803 GTAAATTATCCCAGTGGAGCAGG - Intergenic
1065790763 10:29258365-29258387 CTAAGTTGTGCCAGGATAACAGG + Intergenic
1072636502 10:97181778-97181800 GTAAGTTGTCCGAGGATGGAGGG - Intronic
1072730562 10:97843214-97843236 CTAGGTTGTCCCAAGGCAGCTGG + Intergenic
1074592502 10:114826352-114826374 GTAACTTGTCCAAGTGTAGAAGG - Intronic
1082135116 11:48539441-48539463 GTAAGCTGTCACAGGGTTGTTGG + Intergenic
1082620727 11:55418397-55418419 GTAAGCTGTCCTAGGGTTGTTGG + Intergenic
1084412846 11:69014064-69014086 GAAAGTTGGCCCAGGGTAGGAGG - Intergenic
1088983943 11:114889295-114889317 CTAACTTGTCCCAGTGGAGCAGG + Intergenic
1092162576 12:6324173-6324195 GAAAATTCTCCCAGGGTTGCTGG + Intronic
1097319724 12:58211682-58211704 GTAATTTGTCCCATGTTACCAGG + Intergenic
1100457766 12:94768788-94768810 GTGAATTGTCCCAGGGAAGGAGG + Intergenic
1100585139 12:95972425-95972447 ACAAGTTGTCTCAGGGCAGCTGG - Intergenic
1100749815 12:97686330-97686352 CTAAGTAGTTCCAGGGTTGCTGG + Intergenic
1104416120 12:128597923-128597945 GGCAGAGGTCCCAGGGTAGCTGG + Intronic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1121174100 14:91877535-91877557 GTAATAGGCCCCAGGGTAGCGGG + Exonic
1124415936 15:29473273-29473295 GTAACCTGTCCCTGGGCAGCTGG + Intronic
1124595672 15:31089648-31089670 GTGAACCGTCCCAGGGTAGCTGG - Intronic
1129951340 15:79594319-79594341 GTTAGGTGTCCCAGTCTAGCTGG - Intergenic
1131404139 15:92150089-92150111 GTAAGTCATCCCAGGGCAGCAGG - Intronic
1131491514 15:92867268-92867290 GTTGGTTGTCCCAGGGTTTCTGG + Intergenic
1134360806 16:13529563-13529585 GTAAGTGGTCCCAAGGCAGTTGG - Intergenic
1135185695 16:20313956-20313978 GCAAGCTGTCCAAGGCTAGCGGG - Intronic
1136012304 16:27371804-27371826 GGCAGATGTCCCAGGGAAGCAGG - Intergenic
1139533010 16:67552656-67552678 GGAATTTATCCCAGGGTACCGGG + Intergenic
1139825423 16:69753413-69753435 GTTCCTTGTACCAGGGTAGCAGG - Intronic
1140067822 16:71625883-71625905 GTAAGTTGAGCCAGGGGAGGTGG + Intergenic
1140798056 16:78458977-78458999 TGAAGTTGTCCCAGGCTAGTTGG + Intronic
1149882105 17:60302713-60302735 GTAAGTTTTCCCAGGTTTGAAGG - Intronic
1150052507 17:61978628-61978650 CTAACTTGGCCCAAGGTAGCAGG + Intronic
1150231319 17:63552668-63552690 GTAAGTTTTTCCAGGGTCGTTGG + Intronic
1151404508 17:73877919-73877941 GTAAGTTGTCGCAGTGCAGAGGG - Intergenic
1153162755 18:2227480-2227502 GCAAGTTCTCCCAGGGAAACAGG + Intergenic
1155036797 18:22031309-22031331 GTAATTTCTCCAAGGGGAGCTGG + Intergenic
1155437817 18:25831509-25831531 GCATGTTGTCACAGGGTAGTTGG - Intergenic
1157098915 18:44711978-44712000 GGAAGTTGGCCCAGGGAAGAAGG - Intronic
1159197418 18:65135784-65135806 GGAAGTTGTCTCAGGTTAGGTGG - Intergenic
942322083 2:174744498-174744520 TCAAGTTGTCCCCAGGTAGCTGG - Intergenic
942625402 2:177894987-177895009 ATAAGTGGTCCCAAGGTAGTTGG - Intronic
945638221 2:212386607-212386629 GTAATTTGTCCCAGAGGAGAAGG - Intronic
1176512617 21:7759916-7759938 GGAAGTGGTGCCAAGGTAGCAGG - Intronic
1178646730 21:34390440-34390462 GGAAGTGGTGCCAAGGTAGCAGG - Intronic
1181278088 22:21699349-21699371 GTAACTTGTCTCAGGGCAGAGGG - Exonic
1181474124 22:23158172-23158194 GTAAGTAGTCCGTGGGCAGCTGG - Intronic
1181729618 22:24835203-24835225 GTAACTTGTTCCAGGGCAGCGGG + Intronic
1184290056 22:43493823-43493845 GAAGGTCGTCCCAGGGCAGCAGG + Intronic
1185127295 22:49018172-49018194 GTTAGTTGTCCCAAGGCAGCTGG - Intergenic
949124318 3:427899-427921 GTAATTTGTCTGAGGGTAGAGGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
954116482 3:48469482-48469504 GTAGCTTGGTCCAGGGTAGCTGG + Exonic
956528584 3:70191838-70191860 GTAAATTGTCCCAGGTTACACGG - Intergenic
959779136 3:110206992-110207014 GTAAGTGGTGCCAGGATAACTGG + Intergenic
961960467 3:130849113-130849135 TCAAGTTGGCCCAGGGTATCTGG + Intergenic
962144930 3:132830576-132830598 GAAATTTGTCCCAGGCAAGCTGG - Intergenic
968628292 4:1637764-1637786 GGGAGCTGTCCCAGGGTACCAGG + Intronic
970487207 4:16536629-16536651 GGAAGTCATCCCAGGGTAGAGGG + Intronic
975072411 4:70158431-70158453 GTAAGTATTCCCAGGGTAACTGG - Exonic
985533020 5:444705-444727 GGGAGTTGTCCCTGGGTGGCGGG + Intronic
987247660 5:16064689-16064711 GTCAGTTGCCCTAGGGCAGCTGG - Intergenic
989329782 5:40243296-40243318 GTAACTTGTCTCAGGCTAGTGGG - Intergenic
990436378 5:55796039-55796061 GTATGATGTCCAAGGGTAGTAGG + Intronic
991358734 5:65797786-65797808 GTAAATTGTCTCAGGGCAGATGG - Intronic
991572801 5:68073354-68073376 GTAAGTTGCACCAGGATTGCAGG + Intergenic
993551369 5:89277883-89277905 TTAAGCTATCCCAAGGTAGCTGG + Intergenic
1001711867 5:173785530-173785552 GTAAGTAGTCCCAGGCTGGCTGG - Intergenic
1003454746 6:6271370-6271392 ATGGGTTTTCCCAGGGTAGCTGG - Intronic
1006967556 6:38004054-38004076 GAAAGCTGACCCAGGATAGCTGG - Intronic
1010231502 6:73539262-73539284 GTCAATTGTCCCAGGGGAGGGGG - Intergenic
1010598718 6:77797641-77797663 GTCTGTTGTCCAAGGGTAGGAGG + Intronic
1014133610 6:117863305-117863327 GTAAGTTGATACCGGGTAGCAGG + Intergenic
1017594079 6:156010057-156010079 GTAATTTGTCCAAGGTTGGCGGG + Intergenic
1019858214 7:3630861-3630883 GTAATTTGTCTCAGGGTCTCGGG - Intronic
1021015540 7:15526565-15526587 TTAAGTGGTCCCAAGGCAGCTGG - Intronic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1025995596 7:66525401-66525423 GGCAGTTGTCCCAGGGCAGGTGG + Intergenic
1026966734 7:74444882-74444904 GTAAGATGTAGCAGGGTGGCCGG - Intergenic
1030715164 7:112800840-112800862 GAGAGCTGTTCCAGGGTAGCTGG - Intergenic
1032128617 7:129211947-129211969 TTAAGTGCTCCCAGGGGAGCGGG + Intronic
1032155586 7:129464951-129464973 GTAAGTTATCCCAGAGTTGTGGG + Intronic
1038394566 8:27237257-27237279 GTAATTTGTGCCAGAGGAGCAGG + Intronic
1040460652 8:47644567-47644589 GTAATTTGTCCAAGGTTACCTGG - Intronic
1046598960 8:116295702-116295724 GTAAGTTGTTAAAGAGTAGCAGG + Intergenic
1048577951 8:135707620-135707642 GTTAGTTGTTCCAGAGAAGCTGG + Intergenic
1057859664 9:98630161-98630183 GTCTGTTGTTCCAGGGTATCTGG - Intronic
1060216525 9:121741750-121741772 GGAAGCTGCCCCAGGATAGCTGG - Intronic
1194974592 X:100380791-100380813 GTAAGTTGTAGCAGGGAAACGGG - Intronic
1195958980 X:110365522-110365544 GTAAATTGTCTCAGGAGAGCAGG - Intronic
1196480204 X:116139520-116139542 GTAAGTGGTCCTAGGTAAGCTGG + Intergenic
1198863275 X:141093090-141093112 GTGTGTTGTCCCAGAGTAGCAGG + Intergenic
1198899416 X:141494297-141494319 GTGTGTTGTCCCAGAGTAGCAGG - Intergenic
1200685980 Y:6259291-6259313 GTGGGTTGTCCCAGAGCAGCAGG + Intergenic
1200688346 Y:6277913-6277935 GTGGGTTGTCCTAGAGTAGCAGG + Intergenic
1200991512 Y:9350538-9350560 GTGGGTTGTCCCAGAGTAGCAGG + Intergenic
1200994168 Y:9370814-9370836 GTGGGTTGTCCCAGAGTAGCAGG + Intronic
1200996832 Y:9391149-9391171 GTGGGTTGTCCCAGAGTAGCAGG + Intergenic
1200999347 Y:9459701-9459723 GTGGGTTGTCCCAGAGTAGCAGG + Intergenic
1201002000 Y:9480012-9480034 GTGGGTTGTCCCAGAGTAGCAGG + Intronic
1201004667 Y:9500298-9500320 GTGGGTTGTCCCAGAGTAGCAGG + Intergenic
1201007320 Y:9520624-9520646 GTGGGTTGTCCCAGAGTAGCAGG + Intergenic
1201009957 Y:9540973-9540995 GTGTGTTGTCCCAGAGTAGCAGG + Intergenic
1201012528 Y:9561659-9561681 GTGTGTTGTCCCAGAGTAGCAGG + Intergenic
1201046923 Y:9896779-9896801 GTGGGTTGTCCTAGAGTAGCAGG - Intergenic