ID: 905435195

View in Genome Browser
Species Human (GRCh38)
Location 1:37951022-37951044
Sequence TTTGAACCCAGCCCTTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905435195_905435198 0 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435198 1:37951045-37951067 GTTGAGGGTTAGTGTGCAGAAGG No data
905435195_905435200 15 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435200 1:37951060-37951082 GCAGAAGGGCTCTGAGCTTGTGG No data
905435195_905435202 29 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435202 1:37951074-37951096 AGCTTGTGGATGAGTAGGAATGG No data
905435195_905435201 24 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435201 1:37951069-37951091 CTCTGAGCTTGTGGATGAGTAGG No data
905435195_905435199 1 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435199 1:37951046-37951068 TTGAGGGTTAGTGTGCAGAAGGG No data
905435195_905435203 30 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435203 1:37951075-37951097 GCTTGTGGATGAGTAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905435195 Original CRISPR TTTGAACCCAGCCCTTTGAG AGG (reversed) Intergenic
No off target data available for this crispr