ID: 905435203

View in Genome Browser
Species Human (GRCh38)
Location 1:37951075-37951097
Sequence GCTTGTGGATGAGTAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905435195_905435203 30 Left 905435195 1:37951022-37951044 CCTCTCAAAGGGCTGGGTTCAAA No data
Right 905435203 1:37951075-37951097 GCTTGTGGATGAGTAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905435203 Original CRISPR GCTTGTGGATGAGTAGGAAT GGG Intergenic
No off target data available for this crispr