ID: 905445427

View in Genome Browser
Species Human (GRCh38)
Location 1:38025673-38025695
Sequence GTCTCTTGCCCCTGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905445422_905445427 9 Left 905445422 1:38025641-38025663 CCTGGGGTCAAACAGCTGGATGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 22
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905445427 Original CRISPR GTCTCTTGCCCCTGCTGGGT GGG Intergenic
900854464 1:5169920-5169942 GCCTCACGCCCCTGCTGGCTCGG - Intergenic
900919766 1:5662774-5662796 GCCTCCTGCCCCTGCTGGGAAGG - Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
904294367 1:29508322-29508344 GTCTGTTGGCCATTCTGGGTTGG - Intergenic
904334103 1:29785820-29785842 CTCTCAGGCCCCTGCTGGGGAGG + Intergenic
904566132 1:31429420-31429442 GTCTCGTTGCCCAGCTGGGTTGG - Exonic
904582170 1:31552517-31552539 GTCTGGTGCCTCTGCTGGGATGG + Intergenic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
905603886 1:39279202-39279224 GTCCCTTGAATCTGCTGGGTAGG + Intronic
906191768 1:43903564-43903586 CTCTCTTCCCCCTGCAGGGCTGG - Intronic
906207916 1:43996881-43996903 GTCACGGGCCCCTGCTGGCTGGG + Intronic
909712532 1:78668236-78668258 GAATCTTGCCTGTGCTGGGTAGG + Intergenic
913087396 1:115451607-115451629 GTCTCATGCCCATGCTTGTTGGG - Intergenic
915241373 1:154524732-154524754 GTCTGTCCCCCTTGCTGGGTTGG + Intronic
915486708 1:156226423-156226445 GGTTCTTACCCCTGCTGGGTTGG + Intronic
917860544 1:179139095-179139117 GTGGGTTGCCACTGCTGGGTGGG - Intronic
918266693 1:182848842-182848864 TTCTCTTGCTCCTGCTATGTAGG - Intronic
918429448 1:184443861-184443883 GCCTCCTGTCCCTGCTGGGGAGG + Intronic
921953455 1:220957720-220957742 TTCTTCTGCCCCTGCTAGGTAGG + Intergenic
922417223 1:225432418-225432440 GCATCTTGCCACTGCTGGCTTGG - Intergenic
922749790 1:228064984-228065006 CTCTCTGGACCATGCTGGGTCGG + Intergenic
922769773 1:228175598-228175620 GTCTGCTGCGCCTACTGGGTGGG + Exonic
923574002 1:235141551-235141573 GTGGCTTGCCACTGCTGGCTAGG - Intronic
923829092 1:237535259-237535281 GTCTTTTTCCCCTGCTTAGTAGG - Intronic
924730919 1:246710900-246710922 GTGGGTTGCCTCTGCTGGGTTGG - Intergenic
1063547320 10:6993849-6993871 GTCTATGGCCGCTGCTGGCTGGG + Intergenic
1063775783 10:9262294-9262316 GTATTTTCCCCCTGCTGGATGGG + Intergenic
1064010018 10:11728135-11728157 CTCTCGTGTCCCTGCTGGGGTGG + Intergenic
1064315858 10:14255535-14255557 GTCTCCTGCCCTTGCTGCATTGG - Intronic
1064318256 10:14277806-14277828 CTCTCTGGGCCCTGCTGAGTGGG - Intronic
1064395835 10:14981378-14981400 GTCCCTTGACCTTGCTGGGAAGG - Intronic
1065709657 10:28503298-28503320 GTCATATGCCCCTGCTGGGCTGG + Intergenic
1066390114 10:34971628-34971650 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
1069683490 10:70301316-70301338 GCCTCTGCCCCTTGCTGGGTGGG + Exonic
1073424291 10:103446956-103446978 GTCACCTGGCCCTGCTGGCTGGG + Exonic
1075369013 10:121919101-121919123 GTGGGTTGCCACTGCTGGGTAGG - Intronic
1076598370 10:131639805-131639827 GACTGTTGCCCCTGCTGGGTAGG - Intergenic
1077392867 11:2308098-2308120 GTGCCCTGCCCCTGCTGGGCAGG + Intronic
1077798655 11:5516741-5516763 GATTCATGCCCCTGGTGGGTGGG - Intronic
1079119566 11:17672276-17672298 TTCTCTGGCCCCAGCTGCGTTGG + Intergenic
1080189517 11:29527155-29527177 GTCTTTTGCCCCTCCTTGTTAGG + Intergenic
1081289636 11:41308473-41308495 ATATCTGTCCCCTGCTGGGTGGG + Intronic
1081999793 11:47387992-47388014 GCCCTTTGCCCCTGCTGGCTGGG + Intergenic
1082788122 11:57328514-57328536 CTCCCTTGCCCCTTTTGGGTGGG - Intronic
1084164120 11:67367123-67367145 GTCTCTTGCGCGGGCGGGGTTGG - Intronic
1084261421 11:67981223-67981245 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
1084370098 11:68735570-68735592 GTCTCATGTCCCTGCTGACTTGG - Intronic
1084811226 11:71612886-71612908 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
1086166135 11:83780888-83780910 GTCACTTGTCACTGTTGGGTTGG - Intronic
1090201554 11:124861428-124861450 TTCTCTGGCCCCTGCTGGCTGGG + Intergenic
1090634061 11:128678114-128678136 CTCCCTTGCAACTGCTGGGTAGG - Intergenic
1092264409 12:6970127-6970149 GACTATAGCCACTGCTGGGTCGG + Intronic
1092410807 12:8251750-8251772 GTGTGTTGCCACTGCTGGCTGGG + Intergenic
1093015795 12:14153381-14153403 TTCTCTTGCCCCTGCGGTGGGGG - Intergenic
1093293677 12:17360831-17360853 GTCTATTTTGCCTGCTGGGTAGG + Intergenic
1093747975 12:22764575-22764597 GTGTCTTGGCCCTGGTAGGTTGG + Intergenic
1095468146 12:42509516-42509538 GTCTGTGGTCTCTGCTGGGTGGG + Intronic
1097493128 12:60295667-60295689 GTCTCTTGCACCTGCAGCCTTGG - Intergenic
1098707014 12:73703431-73703453 GTTTCTTGCCCTTGCTGGAGAGG - Intergenic
1100616580 12:96235768-96235790 TTCCCTTTCCCCTGCTGGGTGGG - Intronic
1101131106 12:101692112-101692134 GTCTCATGCTCCAGCTGTGTGGG - Intergenic
1103560681 12:121791986-121792008 GTCTCTAGCCCCTGGTGAGCTGG - Intronic
1104941009 12:132395286-132395308 GTTTCTTCCCCCAGCTGCGTCGG - Intergenic
1105782687 13:23717982-23718004 TTCTCTTGCCTCTGCTTTGTGGG + Intergenic
1106229902 13:27813716-27813738 GTCTCTTCCACCTGCTTGCTGGG + Intergenic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1107490807 13:40878491-40878513 GCCCCTTGCCCTTGCTGGGAAGG - Intergenic
1110324138 13:74194562-74194584 GTCTCTTCCCCCTTGTGAGTGGG - Intergenic
1110551587 13:76816654-76816676 GTCCCTTGCACCTGCTGTGAAGG - Intergenic
1112243866 13:97710339-97710361 GGCTCTTGACTCTGCTGGCTGGG - Intergenic
1112262489 13:97889978-97890000 CTCTCCTGACCCTGCTGGCTGGG - Intergenic
1113182149 13:107641774-107641796 CTCGCTTGCTCCTGCTGAGTTGG - Intronic
1113935246 13:113990503-113990525 GACTCTGGCCTCTGCTGTGTCGG + Intronic
1113988498 13:114339096-114339118 GTCACTGGCCCCTGCAGTGTTGG + Intergenic
1114223198 14:20715362-20715384 GTGTCTTTCCCCTGTTGGCTAGG + Intergenic
1116901110 14:50362867-50362889 GTAGGTTGCCACTGCTGGGTCGG - Intronic
1117038490 14:51749895-51749917 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
1118329276 14:64803120-64803142 GGGTCTTGCACCTGCTGGTTTGG - Intronic
1119870566 14:78013444-78013466 GACGCTTGCCACTGCTGGCTCGG + Intergenic
1120232436 14:81855096-81855118 GTGTCTTTCCCCTACTGGCTAGG + Intergenic
1121996852 14:98609235-98609257 TTTTCTTGCCCCTGCAGGCTTGG + Intergenic
1123146172 14:106132661-106132683 GTGGCTTGCCCCTGCATGGTAGG - Intergenic
1123971637 15:25513362-25513384 GTCTGGTGCTTCTGCTGGGTGGG + Intergenic
1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG + Intronic
1129352922 15:74967641-74967663 GTCTAGTGCCTCTGCTGGGGTGG + Intronic
1129707800 15:77804700-77804722 GCCTCAGGCCACTGCTGGGTGGG - Intronic
1130260666 15:82351915-82351937 CTCCCTTGCACCTGCTGGGAAGG - Intergenic
1130280572 15:82517092-82517114 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130329382 15:82909366-82909388 GTGTCTTTCCCCTGTTGGCTAGG + Intronic
1130471943 15:84233275-84233297 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130479437 15:84347846-84347868 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130492333 15:84440283-84440305 CTCCCTTGCACCTGCTGGGGAGG - Intergenic
1130594239 15:85237912-85237934 CTCCCTTGCACCTGCTGGGAAGG + Intergenic
1130821742 15:87503151-87503173 GGCTCTTGCCCCTCCTGTGAAGG - Intergenic
1131580288 15:93636271-93636293 GGCTCTTGCCCCTGCCTGTTGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132863956 16:2084623-2084645 CTCTCTTGCCCCTGCGTGATGGG - Exonic
1132956758 16:2598379-2598401 TTCTGTGGCCCCTGCTGTGTTGG + Exonic
1133040818 16:3059058-3059080 TCCTCTTGCCCCTGCTGGTGGGG + Exonic
1133736022 16:8616404-8616426 GTCTCTTCTCCCCGCTGAGTGGG + Intergenic
1135481990 16:22828306-22828328 GTCACTTGCCTTTTCTGGGTTGG - Intronic
1136061293 16:27728385-27728407 CTCTCCTTCCCCTGCTGGCTGGG - Intronic
1137389592 16:48070223-48070245 GTCTCATGGCCCTGCAAGGTGGG - Intergenic
1143001971 17:3800348-3800370 GTCTCCTGCCCCTGCTCAGGAGG - Intronic
1143242786 17:5458115-5458137 GTCTCCTGGCCGTCCTGGGTAGG - Intronic
1143263296 17:5616582-5616604 GGCACTTGCCCGTGCTGAGTGGG - Intronic
1145793445 17:27642407-27642429 GTGTCTAAGCCCTGCTGGGTGGG + Intronic
1145808250 17:27749953-27749975 GTGTCTAGGCCCAGCTGGGTGGG + Intergenic
1145865150 17:28236412-28236434 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
1148123222 17:45224245-45224267 GCCTCATGCCCCTGCTGGTGGGG - Intronic
1148582404 17:48752866-48752888 GTTTCTTGGCCCGGCAGGGTGGG + Intergenic
1151877422 17:76874722-76874744 GGCTCTTGCCCCATCTGGGCAGG + Intronic
1151906465 17:77052610-77052632 GGCTCTTGCCCTTGCGGGATGGG - Intergenic
1153022772 18:646465-646487 GTCTTGTGCCCCTGTTGGATAGG - Intronic
1154192971 18:12245768-12245790 CTCTTTTGACCCTGCTGGGTGGG - Intergenic
1155166607 18:23237283-23237305 GTCAGTTGCCCCACCTGGGTTGG + Intronic
1156365033 18:36418123-36418145 CACTCTTGCCCCTTCAGGGTGGG + Intronic
1160810292 19:1010311-1010333 GCCTCTGACCCCTGCTGGCTGGG - Exonic
1161454685 19:4364037-4364059 GTCCCTTCCCCCTGCCGGATGGG - Intronic
1163797460 19:19345787-19345809 GACTCTTGGTCCTGCTGGGCCGG + Intronic
1167273047 19:48517218-48517240 GTTTCTTGCCCATGCAGTGTTGG - Intergenic
927186103 2:20483778-20483800 GCTTCTAGGCCCTGCTGGGTGGG - Intergenic
928273512 2:29878239-29878261 GCCTCTTGCCCTTCCTCGGTGGG - Intronic
930667826 2:54116803-54116825 GTGTCTTTCCCCTACTGGCTAGG + Intronic
931431006 2:62209019-62209041 CACTCTTGCCCAGGCTGGGTCGG + Intronic
932308068 2:70717818-70717840 GGCTCATGCCTCTGGTGGGTGGG + Intronic
932353191 2:71048192-71048214 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
933509632 2:83223558-83223580 GTCTCTAGAGCTTGCTGGGTGGG - Intergenic
933634097 2:84688202-84688224 CTCTGTTGCCCAGGCTGGGTGGG - Intronic
933796594 2:85924909-85924931 GTGTCTTCCCTCTGCTGGGCGGG - Intergenic
934104323 2:88681959-88681981 GTCTCTTGCACCTGCTGCCTTGG - Intergenic
935179659 2:100677978-100678000 GCCTCTAGGTCCTGCTGGGTCGG + Intergenic
935958976 2:108405084-108405106 GTGTCTTTCCCCTGTTGGCTAGG - Intergenic
937771890 2:125729037-125729059 GTGGGTTGCCCCTGCTGGCTAGG - Intergenic
937895903 2:126976689-126976711 GGCTTGTGTCCCTGCTGGGTGGG - Intergenic
938526561 2:132139613-132139635 GTGTCTTTCCCCTACTGGCTAGG + Intergenic
939892705 2:147756417-147756439 GTCTCTTCCTCCTGTTGAGTGGG + Intergenic
940352957 2:152708944-152708966 GTGTCTTTCCCCTACTGGCTAGG - Intronic
940874108 2:158883473-158883495 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
941991067 2:171557742-171557764 GATTCTTTCCCCTGCTGAGTTGG + Exonic
942222981 2:173789627-173789649 GTCTCTTGCCTCAGATGGATGGG - Intergenic
945066838 2:205954831-205954853 GTGTTCTGCCCCAGCTGGGTAGG - Intergenic
946230259 2:218286895-218286917 TGCTCCTGCGCCTGCTGGGTGGG - Intronic
946456007 2:219826682-219826704 GTCTCTGGCCACTGATGGGTGGG - Intergenic
947384279 2:229575661-229575683 GTCCATTGGCCCTGCTGGGATGG - Intronic
947594690 2:231403610-231403632 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
948224186 2:236296091-236296113 GTCCCTTGCCCCTGCTTGGAGGG + Intergenic
948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG + Intronic
948776992 2:240294342-240294364 GTCTCTGGCCCCTGCAGTGAAGG - Intergenic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
948967515 2:241394894-241394916 GGCTCATGCCCCTCCTGAGTAGG - Intronic
1168857943 20:1022394-1022416 ATCTCTTTCCCCTGCTGATTGGG + Intergenic
1168892761 20:1305627-1305649 GTCTCTGGGCCCTGAAGGGTGGG - Exonic
1169354689 20:4896913-4896935 TGCTCCTGCCCCTGCTGGGATGG + Intronic
1169755217 20:9036122-9036144 ACCTCTTGCCCCTGCTTGTTGGG - Intergenic
1169798596 20:9492743-9492765 CACGCTTGCCCTTGCTGGGTTGG + Intergenic
1169919668 20:10721301-10721323 GTCTCATGCCTCTCCTGGGAGGG + Intergenic
1171408248 20:24928373-24928395 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
1173174597 20:40754790-40754812 GGCTCCTGGCCCTGCTGGGGAGG - Intergenic
1176136391 20:63523918-63523940 GTGTCATTCCCCTGTTGGGTGGG + Intergenic
1176168825 20:63688061-63688083 GTCCCTGGGCCCTGCTGGGGTGG + Intronic
1176408318 21:6433923-6433945 GTTCCTTGCCTCTGGTGGGTAGG + Intergenic
1179239089 21:39573081-39573103 GTCAATGGCCCCTGCTGGGAGGG + Intronic
1179683811 21:43042249-43042271 GTTCCTTGCCTCTGGTGGGTAGG + Intergenic
1179915662 21:44476580-44476602 GTCTCTTGCACCTGCGGCCTTGG - Intergenic
1180135879 21:45861403-45861425 GGCTGTTGCCCCAGCTGGCTGGG - Intronic
1183407953 22:37639679-37639701 GGCTCTTGCCCCGGATGGGTGGG - Exonic
1183987420 22:41577178-41577200 GACTCTGGCCCCATCTGGGTGGG + Exonic
1184107409 22:42376188-42376210 ATCTCCTGCCCCTTATGGGTGGG - Intergenic
1184108812 22:42383577-42383599 GTCCCTTGGCCCTGCTAGGGTGG - Exonic
1184188799 22:42881427-42881449 GGCTCTGGCCGCTGCTGAGTCGG + Intronic
1184232941 22:43168311-43168333 GTCTCTTGACTTTGCTGGGGAGG + Intronic
1185175197 22:49322476-49322498 ATCTCTTCGCCCTGCTGGGCAGG - Intergenic
1185214231 22:49589454-49589476 CTCTCTTTCCTCCGCTGGGTAGG - Intronic
951021148 3:17781965-17781987 GTGGCTTGCCACTGCTGGCTGGG - Intronic
951108700 3:18775591-18775613 GTCTCTTCTGCCTGCTGGGAGGG + Intergenic
953347590 3:42189140-42189162 TTCTCTTGCCCCTGCTAGAAGGG + Intronic
954089186 3:48271306-48271328 GTGGCTTGCCGCTGCTGGCTCGG + Intronic
954812163 3:53255206-53255228 GTCTCCTGCCACCCCTGGGTTGG - Intronic
954885031 3:53865309-53865331 GTCTCTTGCTTCTCATGGGTGGG - Exonic
957417774 3:79929036-79929058 GCCCCTTGCCCCTGCAGGTTTGG + Intergenic
960411412 3:117331095-117331117 GTCTCTTGTCCCAGCTACGTGGG - Intergenic
961357563 3:126348760-126348782 GTCTCTTCCCCTTACTGAGTGGG - Intronic
963671241 3:148254529-148254551 GACCATTGCCCCTTCTGGGTGGG + Intergenic
964802761 3:160573529-160573551 GTGGCTTGCCGCTGCTGGCTTGG + Intergenic
965901607 3:173647368-173647390 GTATTTTGCTCCTGTTGGGTGGG - Intronic
966861661 3:184233952-184233974 CTCTCTTCCCACTGCTGGGTGGG - Intronic
967280818 3:187821859-187821881 GTCTCTTGACCCTGCCTGCTTGG - Intergenic
967404014 3:189096221-189096243 GGCTCTTCCCCCTGCTTGGGAGG + Intronic
967583296 3:191185651-191185673 GTTGGTTGCCCCTGCTGGTTAGG - Intergenic
968623085 4:1613070-1613092 GTAGCTTGTCCCTGCCGGGTTGG - Intergenic
969019945 4:4133089-4133111 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
969793496 4:9508381-9508403 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
971758574 4:30734880-30734902 ATTTTCTGCCCCTGCTGGGTGGG + Intronic
971787719 4:31126229-31126251 TTCTCATGCCCCTGCTGCCTGGG + Intronic
973882204 4:55284961-55284983 TTCTCTTGCCCCTATTTGGTTGG + Intergenic
973973421 4:56238497-56238519 GTGTCTTGCTCCACCTGGGTGGG - Intronic
978061370 4:104344593-104344615 GCCTCCTGCCCCTGCAGGCTCGG + Intergenic
980184457 4:129444813-129444835 GTCTCTTACCTCTTCTTGGTTGG + Intergenic
981162635 4:141517036-141517058 CTCCCTTGCTCCTGCTGGGGAGG - Intergenic
981604695 4:146528755-146528777 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
982037640 4:151362142-151362164 ACCTCTTTCCCCTGCTGGATTGG - Intergenic
982610964 4:157574463-157574485 GTCCCTTGCCCCCGCAGGCTCGG + Intergenic
983563412 4:169124684-169124706 GTTGCTTGCCCCTGTGGGGTTGG + Intronic
983570097 4:169197336-169197358 GCCTCTGCGCCCTGCTGGGTGGG - Intronic
985599403 5:818656-818678 CTCTGTTGCCCGTGCTGGTTTGG - Intronic
987186903 5:15430741-15430763 GTCTCTTACTACTGCTGGGTTGG + Intergenic
987301325 5:16600344-16600366 CTCTCCTGACCTTGCTGGGTGGG - Intronic
987322831 5:16786108-16786130 CTCTCCGGCCCCTGGTGGGTAGG - Intronic
988500313 5:31778296-31778318 GCCTCTTGCCACTGCTGGCTGGG - Intronic
991667248 5:69011550-69011572 CTCTCTTGGGCCTGCTGGTTTGG - Intergenic
995679029 5:114696344-114696366 GCCTGTTGCTGCTGCTGGGTGGG - Intergenic
996177162 5:120373049-120373071 GTCTCTGACCACTGCTGGGAAGG - Intergenic
997150374 5:131487334-131487356 GCAGCTTGCCCCTGCTGGCTGGG + Intronic
997472449 5:134124447-134124469 GTCTCTGTCCCTTGCTGGATAGG + Intronic
997472777 5:134125879-134125901 GACTCTTTGCCCTGCTGTGTGGG + Intronic
1000212494 5:159120101-159120123 GACCCTTGCCACTGCTGGCTTGG - Intergenic
1000376334 5:160585725-160585747 GACTCTGGCTCCTGCGGGGTAGG - Intronic
1000541652 5:162548697-162548719 GTGGGTTGCCCCTGCTGGCTGGG - Intergenic
1003105554 6:3212365-3212387 GTCTCTCTCCCCCGCTGGCTTGG + Intergenic
1003271895 6:4614606-4614628 GTGGGTTGCCGCTGCTGGGTGGG + Intergenic
1007401322 6:41604214-41604236 GTCCCTGGCCCCTCCTGGCTAGG - Intergenic
1011608837 6:89130865-89130887 TTCTGTTGCCCAGGCTGGGTTGG + Intergenic
1014057882 6:117037589-117037611 GTCTATTGGCTCTGCTGGATAGG - Intergenic
1014471484 6:121820464-121820486 GTGTCATTCCCCTGCTGGCTAGG - Intergenic
1018152254 6:160951381-160951403 GTGTCTTCCCCCTGCTTGGTTGG - Intergenic
1019742160 7:2680370-2680392 GTCTCCAGTGCCTGCTGGGTGGG - Intronic
1020114706 7:5470109-5470131 ATCTCTAGCCCCTGCTGGGAAGG - Intronic
1020879091 7:13736250-13736272 GTGTCTTGCCCCTGGTAGATGGG - Intergenic
1020880662 7:13758961-13758983 TTCTCTTGCCCTTGCAAGGTAGG - Intergenic
1022507606 7:30916370-30916392 GGCCATGGCCCCTGCTGGGTGGG - Intronic
1023849827 7:44144484-44144506 GTCTCTTGCACCTGCTGCGAGGG + Exonic
1024335470 7:48202175-48202197 GTGGCTTGCCGCTGCTGGCTAGG + Intronic
1026487860 7:70836646-70836668 GTGTCTTTCCCCTGTTGGCTAGG - Intergenic
1026804026 7:73418377-73418399 GTCCCCTGTGCCTGCTGGGTAGG - Intergenic
1028392798 7:90335177-90335199 GCCTATTGCCCCTGCTGGCTGGG - Intergenic
1029078483 7:97954063-97954085 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
1029781965 7:102744141-102744163 GAATCCTGCCCCTGCTGAGTTGG + Intergenic
1031743822 7:125468544-125468566 GCCCCTTGCCCTTGCAGGGTGGG - Intergenic
1032094795 7:128932632-128932654 CTCTCTGGCCCCTGACGGGTAGG - Intergenic
1032540687 7:132700450-132700472 GTCCCTGGCCCCTGCTGTGTTGG - Intronic
1033228147 7:139576806-139576828 GGCTCTTGCCCCTGCTGGGCTGG - Intronic
1034636159 7:152568886-152568908 TTTTCTGGCCCCTGCTGGGCAGG + Intergenic
1036378381 8:8219677-8219699 GTGTGTTGCCACTGCTGGCTGGG - Intergenic
1038298025 8:26314413-26314435 TTCTTTTGCCTCTGCTGTGTTGG + Intronic
1038814413 8:30886600-30886622 GTACCTTGTTCCTGCTGGGTAGG + Intronic
1039063360 8:33589939-33589961 CTCTGTTGCCCAAGCTGGGTTGG - Intergenic
1039182550 8:34882291-34882313 GTGGGTTGCCCCTGCTGGCTGGG - Intergenic
1041296517 8:56362626-56362648 GCCTCTTGCCCATGCTGCTTAGG - Intergenic
1042100747 8:65272633-65272655 GCTTATTGCCCCTACTGGGTGGG - Intergenic
1042919260 8:73906318-73906340 GTGTGTTGCCACTGCTGGCTGGG - Intergenic
1042940569 8:74103193-74103215 GTGTATTGCCTCTGCAGGGTCGG - Intergenic
1043372848 8:79613036-79613058 GTCTCGCGCCCGGGCTGGGTGGG - Intronic
1046930329 8:119835716-119835738 GACTCTAGGCCCTGCTGTGTAGG - Intronic
1048957644 8:139549951-139549973 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
1049275232 8:141717003-141717025 GTCACTTCCCTCTGCTGGCTGGG + Intergenic
1049283637 8:141763019-141763041 GTCTCTTATCCCTGCTGGACAGG - Intergenic
1049537090 8:143187516-143187538 GTCTCTGTCACCTGCTGTGTTGG + Intergenic
1049783803 8:144440943-144440965 GTGTGTGGCCCCGGCTGGGTGGG - Intronic
1051739772 9:20240113-20240135 GTCTCTGGGGCCTGGTGGGTAGG + Intergenic
1051888923 9:21923896-21923918 GTCTCTTGCACCTGCAGCCTTGG - Intronic
1053282400 9:36829204-36829226 CTCTCTAACCCCAGCTGGGTTGG - Intergenic
1057976135 9:99608264-99608286 GTCTCTTAACCCTCCAGGGTAGG - Intergenic
1058801378 9:108547543-108547565 GGCTCTTCCCCCTGCTAGGCTGG - Intergenic
1061002163 9:127908571-127908593 GGCTCTTCTCCCTGCGGGGTGGG + Exonic
1061352763 9:130078831-130078853 GTCACTGGCCCCTCCTGGGTGGG + Intronic
1061943178 9:133893839-133893861 GACTCTCGCCGCTGCTGTGTGGG - Intronic
1062179301 9:135182304-135182326 GTCTCTGTCCCCTGCAGGCTTGG - Intergenic
1062224479 9:135441720-135441742 GTCCCTTGCCCTTGTTGGGAAGG - Intergenic
1062399724 9:136367105-136367127 GTCACATGGCCCTGCTCGGTGGG - Intronic
1189232276 X:39461785-39461807 ATCTCTTTCCCCTGCTTGCTGGG + Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1191725076 X:64270898-64270920 TCTTCTTGCCCCTTCTGGGTAGG - Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1194159961 X:90437580-90437602 GTCTCTTGCACCTGCAGCCTTGG + Intergenic
1194400248 X:93432550-93432572 GTCCCTTGCCCTTGTTGGGAAGG + Intergenic
1194517655 X:94876872-94876894 GTCTCTAGCCATTGCTGGGGAGG + Intergenic
1194575650 X:95611191-95611213 GTTTCTTGGCCATGCTGGGAGGG - Intergenic
1195687647 X:107600973-107600995 TTCTCTCACCCCTGCTGGGGGGG - Exonic
1195739679 X:108050940-108050962 GTTTCTTTCTTCTGCTGGGTGGG - Intronic
1197630563 X:128852978-128853000 GTCTGGTGCTGCTGCTGGGTGGG - Intergenic
1197724768 X:129768935-129768957 GTTTCATGCCCTGGCTGGGTGGG - Exonic
1197728637 X:129792767-129792789 GCCTCTTGCCCTTGCTCTGTCGG - Exonic
1200506254 Y:4014533-4014555 GTCTCTTGCACCTGCAGCCTTGG + Intergenic