ID: 905447134

View in Genome Browser
Species Human (GRCh38)
Location 1:38034773-38034795
Sequence CAGGGTGAAGAGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905447134_905447143 8 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447143 1:38034804-38034826 ACTCTTTGTGAGGCTGGGTGTGG No data
905447134_905447142 3 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447142 1:38034799-38034821 ATGGGACTCTTTGTGAGGCTGGG No data
905447134_905447144 11 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447144 1:38034807-38034829 CTTTGTGAGGCTGGGTGTGGAGG 0: 3
1: 8
2: 98
3: 863
4: 9089
905447134_905447145 14 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447145 1:38034810-38034832 TGTGAGGCTGGGTGTGGAGGTGG No data
905447134_905447146 15 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447146 1:38034811-38034833 GTGAGGCTGGGTGTGGAGGTGGG No data
905447134_905447141 2 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447141 1:38034798-38034820 CATGGGACTCTTTGTGAGGCTGG No data
905447134_905447147 20 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447147 1:38034816-38034838 GCTGGGTGTGGAGGTGGGTCTGG No data
905447134_905447140 -2 Left 905447134 1:38034773-38034795 CCATCTTGCCTCTCTTCACCCTG No data
Right 905447140 1:38034794-38034816 TGTGCATGGGACTCTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905447134 Original CRISPR CAGGGTGAAGAGAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr