ID: 905447516

View in Genome Browser
Species Human (GRCh38)
Location 1:38036689-38036711
Sequence GAGTTAAAGGAGAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905447508_905447516 0 Left 905447508 1:38036666-38036688 CCTGAGTTGAATTTTCTGTGCTG No data
Right 905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG No data
905447507_905447516 1 Left 905447507 1:38036665-38036687 CCCTGAGTTGAATTTTCTGTGCT No data
Right 905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG No data
905447506_905447516 16 Left 905447506 1:38036650-38036672 CCACAGGGTCTTTGACCCTGAGT No data
Right 905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905447516 Original CRISPR GAGTTAAAGGAGAGGGCAGG GGG Intergenic
No off target data available for this crispr