ID: 905449118

View in Genome Browser
Species Human (GRCh38)
Location 1:38046040-38046062
Sequence GCGCACCTGCACCCGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449118_905449130 30 Left 905449118 1:38046040-38046062 CCCGCGCCCGGGTGCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 134
Right 905449130 1:38046093-38046115 ATGTCCGTGTGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
905449118_905449129 29 Left 905449118 1:38046040-38046062 CCCGCGCCCGGGTGCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 134
Right 905449129 1:38046092-38046114 CATGTCCGTGTGCGTGTCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 124
905449118_905449122 -7 Left 905449118 1:38046040-38046062 CCCGCGCCCGGGTGCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 134
Right 905449122 1:38046056-38046078 GGTGCGCCGCCGCCGCGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449118 Original CRISPR GCGCACCTGCACCCGGGCGC GGG (reversed) Exonic