ID: 905449913

View in Genome Browser
Species Human (GRCh38)
Location 1:38049441-38049463
Sequence TGTGCCCTTGGACAAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449913_905449921 25 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449921 1:38049489-38049511 TCCCCTCATTACCGTGGGATGGG No data
905449913_905449923 26 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449923 1:38049490-38049512 CCCCTCATTACCGTGGGATGGGG No data
905449913_905449925 27 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449913_905449919 20 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449919 1:38049484-38049506 ATCATTCCCCTCATTACCGTGGG No data
905449913_905449918 19 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449918 1:38049483-38049505 CATCATTCCCCTCATTACCGTGG No data
905449913_905449920 24 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449920 1:38049488-38049510 TTCCCCTCATTACCGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449913 Original CRISPR TGTGCCCTTGGACAAATTTT GGG (reversed) Intergenic
No off target data available for this crispr