ID: 905449914

View in Genome Browser
Species Human (GRCh38)
Location 1:38049442-38049464
Sequence CTGTGCCCTTGGACAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449914_905449919 19 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449919 1:38049484-38049506 ATCATTCCCCTCATTACCGTGGG No data
905449914_905449923 25 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449923 1:38049490-38049512 CCCCTCATTACCGTGGGATGGGG No data
905449914_905449921 24 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449921 1:38049489-38049511 TCCCCTCATTACCGTGGGATGGG No data
905449914_905449920 23 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449920 1:38049488-38049510 TTCCCCTCATTACCGTGGGATGG No data
905449914_905449918 18 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449918 1:38049483-38049505 CATCATTCCCCTCATTACCGTGG No data
905449914_905449925 26 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449914 Original CRISPR CTGTGCCCTTGGACAAATTT TGG (reversed) Intergenic
No off target data available for this crispr