ID: 905449916

View in Genome Browser
Species Human (GRCh38)
Location 1:38049453-38049475
Sequence ACTCACAGGTCCTGTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449916_905449921 13 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449921 1:38049489-38049511 TCCCCTCATTACCGTGGGATGGG No data
905449916_905449927 22 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449927 1:38049498-38049520 TACCGTGGGATGGGGGTCTATGG No data
905449916_905449918 7 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449918 1:38049483-38049505 CATCATTCCCCTCATTACCGTGG No data
905449916_905449929 25 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449929 1:38049501-38049523 CGTGGGATGGGGGTCTATGGAGG No data
905449916_905449925 15 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449916_905449919 8 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449919 1:38049484-38049506 ATCATTCCCCTCATTACCGTGGG No data
905449916_905449923 14 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449923 1:38049490-38049512 CCCCTCATTACCGTGGGATGGGG No data
905449916_905449920 12 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449920 1:38049488-38049510 TTCCCCTCATTACCGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449916 Original CRISPR ACTCACAGGTCCTGTGCCCT TGG (reversed) Intergenic
No off target data available for this crispr