ID: 905449917

View in Genome Browser
Species Human (GRCh38)
Location 1:38049467-38049489
Sequence AATGATGAGTGAAAACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449917_905449923 0 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449923 1:38049490-38049512 CCCCTCATTACCGTGGGATGGGG No data
905449917_905449921 -1 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449921 1:38049489-38049511 TCCCCTCATTACCGTGGGATGGG No data
905449917_905449930 23 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449930 1:38049513-38049535 GTCTATGGAGGCAGCAGCTTTGG No data
905449917_905449929 11 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449929 1:38049501-38049523 CGTGGGATGGGGGTCTATGGAGG No data
905449917_905449931 27 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449931 1:38049517-38049539 ATGGAGGCAGCAGCTTTGGCTGG No data
905449917_905449927 8 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449927 1:38049498-38049520 TACCGTGGGATGGGGGTCTATGG No data
905449917_905449918 -7 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449918 1:38049483-38049505 CATCATTCCCCTCATTACCGTGG No data
905449917_905449925 1 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449917_905449919 -6 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449919 1:38049484-38049506 ATCATTCCCCTCATTACCGTGGG No data
905449917_905449920 -2 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449920 1:38049488-38049510 TTCCCCTCATTACCGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449917 Original CRISPR AATGATGAGTGAAAACTCAC AGG (reversed) Intergenic
No off target data available for this crispr