ID: 905449925

View in Genome Browser
Species Human (GRCh38)
Location 1:38049491-38049513
Sequence CCCTCATTACCGTGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905449913_905449925 27 Left 905449913 1:38049441-38049463 CCCAAAATTTGTCCAAGGGCACA No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449917_905449925 1 Left 905449917 1:38049467-38049489 CCTGTGAGTTTTCACTCATCATT No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449916_905449925 15 Left 905449916 1:38049453-38049475 CCAAGGGCACAGGACCTGTGAGT No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data
905449914_905449925 26 Left 905449914 1:38049442-38049464 CCAAAATTTGTCCAAGGGCACAG No data
Right 905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905449925 Original CRISPR CCCTCATTACCGTGGGATGG GGG Intergenic
No off target data available for this crispr