ID: 905450085

View in Genome Browser
Species Human (GRCh38)
Location 1:38050750-38050772
Sequence AACCATGTGGACCAAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905450085_905450089 -7 Left 905450085 1:38050750-38050772 CCCAGAGTTTGGTCCACATGGTT No data
Right 905450089 1:38050766-38050788 CATGGTTTGGTTGCAGCGCTAGG No data
905450085_905450090 0 Left 905450085 1:38050750-38050772 CCCAGAGTTTGGTCCACATGGTT No data
Right 905450090 1:38050773-38050795 TGGTTGCAGCGCTAGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905450085 Original CRISPR AACCATGTGGACCAAACTCT GGG (reversed) Intergenic
No off target data available for this crispr