ID: 905451340

View in Genome Browser
Species Human (GRCh38)
Location 1:38058771-38058793
Sequence TTGGACACACAAGGACACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905451340_905451345 4 Left 905451340 1:38058771-38058793 CCAAGGTGTCCTTGTGTGTCCAA No data
Right 905451345 1:38058798-38058820 CAAAAGGCAGCTGATGTTGCTGG No data
905451340_905451347 20 Left 905451340 1:38058771-38058793 CCAAGGTGTCCTTGTGTGTCCAA No data
Right 905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG No data
905451340_905451346 14 Left 905451340 1:38058771-38058793 CCAAGGTGTCCTTGTGTGTCCAA No data
Right 905451346 1:38058808-38058830 CTGATGTTGCTGGAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905451340 Original CRISPR TTGGACACACAAGGACACCT TGG (reversed) Intergenic
No off target data available for this crispr