ID: 905451347

View in Genome Browser
Species Human (GRCh38)
Location 1:38058814-38058836
Sequence TTGCTGGAGCAGAGTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905451342_905451347 11 Left 905451342 1:38058780-38058802 CCTTGTGTGTCCAAGGAACAAAA No data
Right 905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG No data
905451344_905451347 1 Left 905451344 1:38058790-38058812 CCAAGGAACAAAAGGCAGCTGAT No data
Right 905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG No data
905451340_905451347 20 Left 905451340 1:38058771-38058793 CCAAGGTGTCCTTGTGTGTCCAA No data
Right 905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905451347 Original CRISPR TTGCTGGAGCAGAGTGGCAG AGG Intergenic
No off target data available for this crispr