ID: 905456861

View in Genome Browser
Species Human (GRCh38)
Location 1:38094376-38094398
Sequence TCCAAGTCCCACGTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905456855_905456861 11 Left 905456855 1:38094342-38094364 CCTCACAGCAAAGCCCCTAGGAC No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456852_905456861 16 Left 905456852 1:38094337-38094359 CCCATCCTCACAGCAAAGCCCCT No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456856_905456861 -2 Left 905456856 1:38094355-38094377 CCCCTAGGACTTAGAAATGACTC No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456858_905456861 -4 Left 905456858 1:38094357-38094379 CCTAGGACTTAGAAATGACTCCA No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456851_905456861 24 Left 905456851 1:38094329-38094351 CCTGCAGTCCCATCCTCACAGCA No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456857_905456861 -3 Left 905456857 1:38094356-38094378 CCCTAGGACTTAGAAATGACTCC No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456850_905456861 29 Left 905456850 1:38094324-38094346 CCTGGCCTGCAGTCCCATCCTCA No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456853_905456861 15 Left 905456853 1:38094338-38094360 CCATCCTCACAGCAAAGCCCCTA No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data
905456849_905456861 30 Left 905456849 1:38094323-38094345 CCCTGGCCTGCAGTCCCATCCTC No data
Right 905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905456861 Original CRISPR TCCAAGTCCCACGTGGCTCT GGG Intergenic
No off target data available for this crispr