ID: 905459637

View in Genome Browser
Species Human (GRCh38)
Location 1:38114177-38114199
Sequence TGGGCCCTTGGTGGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905459631_905459637 -10 Left 905459631 1:38114164-38114186 CCAGCCTGGAACCTGGGCCCTTG No data
Right 905459637 1:38114177-38114199 TGGGCCCTTGGTGGTTGGCCAGG No data
905459626_905459637 16 Left 905459626 1:38114138-38114160 CCTGAGCATGGGGCTCGCAGCTG No data
Right 905459637 1:38114177-38114199 TGGGCCCTTGGTGGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905459637 Original CRISPR TGGGCCCTTGGTGGTTGGCC AGG Intergenic