ID: 905460953

View in Genome Browser
Species Human (GRCh38)
Location 1:38122789-38122811
Sequence ATTTTTGCAGGGCTGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905460943_905460953 19 Left 905460943 1:38122747-38122769 CCTGCACACTGGAGGGTGGGGTT No data
Right 905460953 1:38122789-38122811 ATTTTTGCAGGGCTGTCCTGGGG No data
905460940_905460953 22 Left 905460940 1:38122744-38122766 CCTCCTGCACACTGGAGGGTGGG No data
Right 905460953 1:38122789-38122811 ATTTTTGCAGGGCTGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905460953 Original CRISPR ATTTTTGCAGGGCTGTCCTG GGG Intergenic
No off target data available for this crispr