ID: 905465224

View in Genome Browser
Species Human (GRCh38)
Location 1:38148097-38148119
Sequence AGTTATCTGAAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905465224_905465229 22 Left 905465224 1:38148097-38148119 CCTACCATCTTCTTCAGATAACT No data
Right 905465229 1:38148142-38148164 CTTAGCCTGTTACTGGGCTTTGG 0: 9
1: 177
2: 167
3: 118
4: 218
905465224_905465228 16 Left 905465224 1:38148097-38148119 CCTACCATCTTCTTCAGATAACT No data
Right 905465228 1:38148136-38148158 ACAGCTCTTAGCCTGTTACTGGG No data
905465224_905465227 15 Left 905465224 1:38148097-38148119 CCTACCATCTTCTTCAGATAACT No data
Right 905465227 1:38148135-38148157 AACAGCTCTTAGCCTGTTACTGG No data
905465224_905465230 25 Left 905465224 1:38148097-38148119 CCTACCATCTTCTTCAGATAACT No data
Right 905465230 1:38148145-38148167 AGCCTGTTACTGGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905465224 Original CRISPR AGTTATCTGAAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr