ID: 905465562

View in Genome Browser
Species Human (GRCh38)
Location 1:38150644-38150666
Sequence GCTGCTAGTGATTATAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905465557_905465562 10 Left 905465557 1:38150611-38150633 CCCTCCCTTAACTGGGTAGGCAC No data
Right 905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG No data
905465559_905465562 6 Left 905465559 1:38150615-38150637 CCCTTAACTGGGTAGGCACCATT No data
Right 905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG No data
905465560_905465562 5 Left 905465560 1:38150616-38150638 CCTTAACTGGGTAGGCACCATTT No data
Right 905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG No data
905465558_905465562 9 Left 905465558 1:38150612-38150634 CCTCCCTTAACTGGGTAGGCACC No data
Right 905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905465562 Original CRISPR GCTGCTAGTGATTATAAAGC AGG Intergenic
No off target data available for this crispr