ID: 905468785

View in Genome Browser
Species Human (GRCh38)
Location 1:38176020-38176042
Sequence TGCCCCCATCACCCAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905468785_905468794 7 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468785_905468796 27 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468785_905468791 -6 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468791 1:38176037-38176059 GGGGCAAGCCCAGGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905468785 Original CRISPR TGCCCCCATCACCCAGGGCA TGG (reversed) Intergenic
No off target data available for this crispr