ID: 905468791

View in Genome Browser
Species Human (GRCh38)
Location 1:38176037-38176059
Sequence GGGGCAAGCCCAGGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905468778_905468791 5 Left 905468778 1:38176009-38176031 CCTCTGGCTACCCATGCCCTGGG No data
Right 905468791 1:38176037-38176059 GGGGCAAGCCCAGGGGAAGCAGG No data
905468785_905468791 -6 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468791 1:38176037-38176059 GGGGCAAGCCCAGGGGAAGCAGG No data
905468776_905468791 8 Left 905468776 1:38176006-38176028 CCACCTCTGGCTACCCATGCCCT No data
Right 905468791 1:38176037-38176059 GGGGCAAGCCCAGGGGAAGCAGG No data
905468784_905468791 -5 Left 905468784 1:38176019-38176041 CCCATGCCCTGGGTGATGGGGGC No data
Right 905468791 1:38176037-38176059 GGGGCAAGCCCAGGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905468791 Original CRISPR GGGGCAAGCCCAGGGGAAGC AGG Intergenic
No off target data available for this crispr