ID: 905468794

View in Genome Browser
Species Human (GRCh38)
Location 1:38176050-38176072
Sequence GGGAAGCAGGCCACTTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905468786_905468794 2 Left 905468786 1:38176025-38176047 CCCTGGGTGATGGGGGCAAGCCC No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468784_905468794 8 Left 905468784 1:38176019-38176041 CCCATGCCCTGGGTGATGGGGGC No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468776_905468794 21 Left 905468776 1:38176006-38176028 CCACCTCTGGCTACCCATGCCCT No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468787_905468794 1 Left 905468787 1:38176026-38176048 CCTGGGTGATGGGGGCAAGCCCA No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468785_905468794 7 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data
905468778_905468794 18 Left 905468778 1:38176009-38176031 CCTCTGGCTACCCATGCCCTGGG No data
Right 905468794 1:38176050-38176072 GGGAAGCAGGCCACTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905468794 Original CRISPR GGGAAGCAGGCCACTTGCTC AGG Intergenic
No off target data available for this crispr