ID: 905468796

View in Genome Browser
Species Human (GRCh38)
Location 1:38176070-38176092
Sequence AGGACCCTAGACTCTCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905468785_905468796 27 Left 905468785 1:38176020-38176042 CCATGCCCTGGGTGATGGGGGCA No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468787_905468796 21 Left 905468787 1:38176026-38176048 CCTGGGTGATGGGGGCAAGCCCA No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468784_905468796 28 Left 905468784 1:38176019-38176041 CCCATGCCCTGGGTGATGGGGGC No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468793_905468796 1 Left 905468793 1:38176046-38176068 CCAGGGGAAGCAGGCCACTTGCT No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468786_905468796 22 Left 905468786 1:38176025-38176047 CCCTGGGTGATGGGGGCAAGCCC No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data
905468792_905468796 2 Left 905468792 1:38176045-38176067 CCCAGGGGAAGCAGGCCACTTGC No data
Right 905468796 1:38176070-38176092 AGGACCCTAGACTCTCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905468796 Original CRISPR AGGACCCTAGACTCTCAGCA CGG Intergenic
No off target data available for this crispr