ID: 905470058

View in Genome Browser
Species Human (GRCh38)
Location 1:38185102-38185124
Sequence AGAAGGCATCTGGGGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905470053_905470058 -10 Left 905470053 1:38185089-38185111 CCAGTGTCTAAGCAGAAGGCATC No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data
905470045_905470058 29 Left 905470045 1:38185050-38185072 CCTCCTAATCTGGGGAAGCTAAA No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data
905470047_905470058 26 Left 905470047 1:38185053-38185075 CCTAATCTGGGGAAGCTAAAGGG No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data
905470052_905470058 -9 Left 905470052 1:38185088-38185110 CCCAGTGTCTAAGCAGAAGGCAT No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data
905470049_905470058 3 Left 905470049 1:38185076-38185098 CCAGACCACAAGCCCAGTGTCTA No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data
905470050_905470058 -2 Left 905470050 1:38185081-38185103 CCACAAGCCCAGTGTCTAAGCAG No data
Right 905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905470058 Original CRISPR AGAAGGCATCTGGGGAAACT GGG Intergenic
No off target data available for this crispr