ID: 905470152

View in Genome Browser
Species Human (GRCh38)
Location 1:38185725-38185747
Sequence CCTCCCTGGCAGACACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905470145_905470152 18 Left 905470145 1:38185684-38185706 CCACGCTTGGCCCAAAGACTTGC No data
Right 905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG No data
905470147_905470152 7 Left 905470147 1:38185695-38185717 CCAAAGACTTGCTTCAGTGACAT No data
Right 905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG No data
905470144_905470152 21 Left 905470144 1:38185681-38185703 CCACCACGCTTGGCCCAAAGACT No data
Right 905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG No data
905470146_905470152 8 Left 905470146 1:38185694-38185716 CCCAAAGACTTGCTTCAGTGACA No data
Right 905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905470152 Original CRISPR CCTCCCTGGCAGACACTGGG AGG Intergenic
No off target data available for this crispr