ID: 905484721

View in Genome Browser
Species Human (GRCh38)
Location 1:38287185-38287207
Sequence GAAGAGGCCCACAGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484721_905484736 28 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484721_905484733 20 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484721_905484728 2 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484728 1:38287210-38287232 TGGGTCCATCCTCCTAGAGCAGG No data
905484721_905484734 21 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484734 1:38287229-38287251 CAGGCCACAGTGCGAGGCGTGGG No data
905484721_905484732 15 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484721 Original CRISPR GAAGAGGCCCACAGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr