ID: 905484723

View in Genome Browser
Species Human (GRCh38)
Location 1:38287191-38287213
Sequence CCCAGGGAAGAGGCCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484723_905484736 22 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484723_905484728 -4 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484728 1:38287210-38287232 TGGGTCCATCCTCCTAGAGCAGG No data
905484723_905484733 14 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484723_905484734 15 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484734 1:38287229-38287251 CAGGCCACAGTGCGAGGCGTGGG No data
905484723_905484732 9 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484723 Original CRISPR CCCAGGGAAGAGGCCCACAG AGG (reversed) Intergenic
No off target data available for this crispr