ID: 905484725

View in Genome Browser
Species Human (GRCh38)
Location 1:38287201-38287223
Sequence GGAGGATGGACCCAGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484725_905484734 5 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484734 1:38287229-38287251 CAGGCCACAGTGCGAGGCGTGGG No data
905484725_905484733 4 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484725_905484736 12 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484725_905484737 26 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484725_905484732 -1 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484725 Original CRISPR GGAGGATGGACCCAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr