ID: 905484726

View in Genome Browser
Species Human (GRCh38)
Location 1:38287207-38287229
Sequence GCTCTAGGAGGATGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484726_905484736 6 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484726_905484733 -2 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484726_905484734 -1 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484734 1:38287229-38287251 CAGGCCACAGTGCGAGGCGTGGG No data
905484726_905484738 26 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484738 1:38287256-38287278 AGGCAGCTGCTTGCAGGTGTTGG No data
905484726_905484740 28 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484740 1:38287258-38287280 GCAGCTGCTTGCAGGTGTTGGGG No data
905484726_905484737 20 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484726_905484732 -7 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484726_905484739 27 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484726 Original CRISPR GCTCTAGGAGGATGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr