ID: 905484729

View in Genome Browser
Species Human (GRCh38)
Location 1:38287215-38287237
Sequence TGTGGCCTGCTCTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484729_905484740 20 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484740 1:38287258-38287280 GCAGCTGCTTGCAGGTGTTGGGG No data
905484729_905484733 -10 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484729_905484736 -2 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484729_905484734 -9 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484734 1:38287229-38287251 CAGGCCACAGTGCGAGGCGTGGG No data
905484729_905484738 18 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484738 1:38287256-38287278 AGGCAGCTGCTTGCAGGTGTTGG No data
905484729_905484737 12 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484729_905484739 19 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484729 Original CRISPR TGTGGCCTGCTCTAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr