ID: 905484730

View in Genome Browser
Species Human (GRCh38)
Location 1:38287219-38287241
Sequence GCACTGTGGCCTGCTCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484730_905484739 15 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484730_905484737 8 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484730_905484736 -6 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484730_905484738 14 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484738 1:38287256-38287278 AGGCAGCTGCTTGCAGGTGTTGG No data
905484730_905484740 16 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484740 1:38287258-38287280 GCAGCTGCTTGCAGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484730 Original CRISPR GCACTGTGGCCTGCTCTAGG AGG (reversed) Intergenic
No off target data available for this crispr