ID: 905484731

View in Genome Browser
Species Human (GRCh38)
Location 1:38287222-38287244
Sequence CTCGCACTGTGGCCTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484731_905484739 12 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484731_905484738 11 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484738 1:38287256-38287278 AGGCAGCTGCTTGCAGGTGTTGG No data
905484731_905484740 13 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484740 1:38287258-38287280 GCAGCTGCTTGCAGGTGTTGGGG No data
905484731_905484737 5 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484731_905484736 -9 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484731 Original CRISPR CTCGCACTGTGGCCTGCTCT AGG (reversed) Intergenic
No off target data available for this crispr