ID: 905484732

View in Genome Browser
Species Human (GRCh38)
Location 1:38287223-38287245
Sequence CTAGAGCAGGCCACAGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484726_905484732 -7 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484718_905484732 22 Left 905484718 1:38287178-38287200 CCCACTTCCAGGGCCTCTGTGGG No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484720_905484732 21 Left 905484720 1:38287179-38287201 CCACTTCCAGGGCCTCTGTGGGC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484721_905484732 15 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484715_905484732 29 Left 905484715 1:38287171-38287193 CCCTGAACCCACTTCCAGGGCCT No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484725_905484732 -1 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484723_905484732 9 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484716_905484732 28 Left 905484716 1:38287172-38287194 CCTGAACCCACTTCCAGGGCCTC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484714_905484732 30 Left 905484714 1:38287170-38287192 CCCCTGAACCCACTTCCAGGGCC No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data
905484727_905484732 -8 Left 905484727 1:38287208-38287230 CCTGGGTCCATCCTCCTAGAGCA No data
Right 905484732 1:38287223-38287245 CTAGAGCAGGCCACAGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484732 Original CRISPR CTAGAGCAGGCCACAGTGCG AGG Intergenic
No off target data available for this crispr