ID: 905484733

View in Genome Browser
Species Human (GRCh38)
Location 1:38287228-38287250
Sequence GCAGGCCACAGTGCGAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484723_905484733 14 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484725_905484733 4 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484726_905484733 -2 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484729_905484733 -10 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484721_905484733 20 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484720_905484733 26 Left 905484720 1:38287179-38287201 CCACTTCCAGGGCCTCTGTGGGC No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484718_905484733 27 Left 905484718 1:38287178-38287200 CCCACTTCCAGGGCCTCTGTGGG No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data
905484727_905484733 -3 Left 905484727 1:38287208-38287230 CCTGGGTCCATCCTCCTAGAGCA No data
Right 905484733 1:38287228-38287250 GCAGGCCACAGTGCGAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484733 Original CRISPR GCAGGCCACAGTGCGAGGCG TGG Intergenic
No off target data available for this crispr